Incidental Mutation 'R8297:Pramef25'
ID639006
Institutional Source Beutler Lab
Gene Symbol Pramef25
Ensembl Gene ENSMUSG00000078511
Gene NamePRAME family member 25
SynonymsGm13109
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R8297 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location143948580-143951016 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 143949120 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 379 (T379S)
Ref Sequence ENSEMBL: ENSMUSP00000101392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105766]
Predicted Effect probably benign
Transcript: ENSMUST00000105766
AA Change: T379S

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000101392
Gene: ENSMUSG00000078511
AA Change: T379S

DomainStartEndE-ValueType
SCOP:d1a4ya_ 223 427 2e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T C 10: 21,621,679 L73P probably damaging Het
4933412E24Rik T G 15: 60,015,675 R305S probably damaging Het
Adamts19 T A 18: 58,837,848 V168E probably damaging Het
Ankrd34b T A 13: 92,439,589 L443Q probably damaging Het
Ano3 A G 2: 110,661,271 Y887H probably damaging Het
Arhgef2 A T 3: 88,639,432 H553L probably benign Het
Atxn1 G T 13: 45,567,029 N463K probably benign Het
Birc6 A G 17: 74,625,104 probably null Het
C4bp A G 1: 130,636,745 S401P probably damaging Het
Cd5 T A 19: 10,720,245 R457W probably damaging Het
Chek2 T G 5: 110,848,436 Y127D probably damaging Het
Clec4a1 G A 6: 122,922,001 V10M probably damaging Het
Cltc A G 11: 86,712,631 Y790H probably damaging Het
Cops2 T C 2: 125,859,108 probably benign Het
Cyb5d2 A G 11: 72,789,103 F122S probably damaging Het
Daam1 T A 12: 71,951,915 L548H unknown Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dsg1a A C 18: 20,332,033 N427T probably benign Het
Ear14 A T 14: 51,204,107 D140V probably damaging Het
Epha4 A C 1: 77,506,910 F154C probably damaging Het
Ets2 G A 16: 95,706,454 V12M probably damaging Het
Fbxo40 G A 16: 36,969,308 T480I probably damaging Het
Fdps A T 3: 89,093,741 Y322N probably damaging Het
Gca T C 2: 62,686,356 M132T probably benign Het
Ifi203 T G 1: 173,937,930 K26T probably damaging Het
Itga10 A G 3: 96,654,800 R668G probably damaging Het
Itgal T C 7: 127,330,466 I1185T unknown Het
Kcnj13 A T 1: 87,386,467 N344K probably damaging Het
Kdm5a A T 6: 120,381,555 L186F probably benign Het
Klhl8 T C 5: 103,863,088 N624D probably benign Het
Klrb1 G T 6: 128,712,259 T83K possibly damaging Het
Krt77 TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 15: 101,859,972 probably benign Het
Ltb G T 17: 35,194,679 R53L probably benign Het
Mterf3 A G 13: 66,907,158 V69A Het
Mvb12a A G 8: 71,545,244 K101E probably damaging Het
Nbeal2 T A 9: 110,635,341 Q1110L possibly damaging Het
Neb T A 2: 52,308,763 T389S possibly damaging Het
Nol4 A G 18: 23,040,012 F11L probably damaging Het
Olfr132 A G 17: 38,130,593 S200P probably damaging Het
Olfr441 A G 6: 43,116,506 I255V probably benign Het
Olfr675 C T 7: 105,024,678 G97R probably benign Het
Olfr9 T C 10: 128,990,839 L309P possibly damaging Het
Pde2a T A 7: 101,504,673 Y487N possibly damaging Het
Pde4a C T 9: 21,166,108 P61S possibly damaging Het
Prr5l A G 2: 101,741,285 probably null Het
Ptpn6 G A 6: 124,728,651 T179I possibly damaging Het
Ralyl T C 3: 14,039,776 S34P probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Robo2 A T 16: 74,015,926 C293* probably null Het
Rtn4 T G 11: 29,705,536 D169E probably damaging Het
Slc22a22 A T 15: 57,259,110 V157E probably damaging Het
Sytl2 A G 7: 90,385,075 T498A probably benign Het
Tgm6 G A 2: 130,137,438 V163I probably benign Het
Tnpo3 A T 6: 29,582,303 C187S possibly damaging Het
Ttn A G 2: 76,786,141 probably null Het
Vangl2 C A 1: 172,009,946 V99F possibly damaging Het
Vmn1r167 C T 7: 23,504,790 C267Y probably damaging Het
Vsig10l T C 7: 43,464,107 V161A possibly damaging Het
Xrcc5 G A 1: 72,325,085 R232Q possibly damaging Het
Xrcc6 C G 15: 82,029,262 F365L probably damaging Het
Zcchc11 G A 4: 108,479,708 A210T possibly damaging Het
Zdhhc13 A G 7: 48,815,509 Y389C probably damaging Het
Other mutations in Pramef25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Pramef25 APN 4 143950214 splice site probably benign
IGL01562:Pramef25 APN 4 143950865 missense probably damaging 1.00
IGL02422:Pramef25 APN 4 143949883 missense probably benign 0.25
IGL02632:Pramef25 APN 4 143949937 missense possibly damaging 0.84
IGL02745:Pramef25 APN 4 143950724 missense probably damaging 1.00
IGL02808:Pramef25 APN 4 143951015 utr 5 prime probably benign
IGL02883:Pramef25 APN 4 143949848 missense possibly damaging 0.64
IGL02961:Pramef25 APN 4 143949147 missense probably damaging 1.00
IGL03092:Pramef25 APN 4 143950197 missense probably damaging 0.97
FR4340:Pramef25 UTSW 4 143949742 missense probably damaging 0.99
FR4342:Pramef25 UTSW 4 143949742 missense probably damaging 0.99
FR4342:Pramef25 UTSW 4 143949757 frame shift probably null
R0533:Pramef25 UTSW 4 143950720 missense possibly damaging 0.85
R0606:Pramef25 UTSW 4 143949883 missense probably benign 0.25
R1624:Pramef25 UTSW 4 143949830 missense possibly damaging 0.47
R1898:Pramef25 UTSW 4 143950728 missense probably damaging 1.00
R2029:Pramef25 UTSW 4 143949883 missense probably benign 0.25
R2867:Pramef25 UTSW 4 143948886 missense probably benign 0.00
R2867:Pramef25 UTSW 4 143948886 missense probably benign 0.00
R2894:Pramef25 UTSW 4 143949122 missense probably damaging 1.00
R4111:Pramef25 UTSW 4 143949905 missense possibly damaging 0.93
R4298:Pramef25 UTSW 4 143949143 nonsense probably null
R4360:Pramef25 UTSW 4 143950863 missense possibly damaging 0.81
R4361:Pramef25 UTSW 4 143950863 missense possibly damaging 0.81
R5137:Pramef25 UTSW 4 143949120 missense probably benign 0.08
R5195:Pramef25 UTSW 4 143950880 missense probably damaging 0.99
R5312:Pramef25 UTSW 4 143949095 missense possibly damaging 0.96
R5548:Pramef25 UTSW 4 143949980 missense probably benign 0.24
R5591:Pramef25 UTSW 4 143948807 missense probably damaging 1.00
R5644:Pramef25 UTSW 4 143948804 missense probably benign 0.01
R6018:Pramef25 UTSW 4 143950899 missense possibly damaging 0.61
R6177:Pramef25 UTSW 4 143949006 missense possibly damaging 0.51
R6335:Pramef25 UTSW 4 143949032 missense probably benign 0.02
R6376:Pramef25 UTSW 4 143950697 missense probably benign 0.03
R6572:Pramef25 UTSW 4 143949692 missense probably benign 0.01
R6845:Pramef25 UTSW 4 143949824 missense probably benign
R6939:Pramef25 UTSW 4 143948796 missense probably benign 0.09
R7081:Pramef25 UTSW 4 143949278 missense probably damaging 1.00
R7505:Pramef25 UTSW 4 143949703 missense possibly damaging 0.94
R7711:Pramef25 UTSW 4 143949252 missense probably benign 0.22
R8284:Pramef25 UTSW 4 143950125 missense possibly damaging 0.95
R8299:Pramef25 UTSW 4 143950757 missense probably benign 0.24
RF011:Pramef25 UTSW 4 143948908 missense probably damaging 0.96
RF013:Pramef25 UTSW 4 143948908 missense probably damaging 0.96
RF021:Pramef25 UTSW 4 143948908 missense probably damaging 0.96
Z1176:Pramef25 UTSW 4 143950123 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GAAAGCTGGACAAATCTCTCTGC -3'
(R):5'- GCTCTCTGCAAGTACTCACAG -3'

Sequencing Primer
(F):5'- AGCTGGACAAATCTCTCTGCTCTAAG -3'
(R):5'- TGCAAGTACTCACAGTCAGACATGG -3'
Posted On2020-07-28