Mutagenetix > Incidental Mutation

Incidental Mutation 'R8297:Chek2'

639008

Institutional Source

Beutler Lab

Gene Symbol

Chek2

Ensembl Gene

ENSMUSG00000029521

Gene Name

checkpoint kinase 2

Synonyms

CHK2, Rad53

MMRRC Submission

067853-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8297 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110987845-111022011 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 110996302 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Aspartic acid at position 127 (Y127D)

Ref Sequence

ENSEMBL: ENSMUSP00000066679 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066160] [ENSMUST00000199937]

AlphaFold

Q9Z265

Predicted Effect

probably damaging
Transcript: ENSMUST00000066160
AA Change: Y127D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000066679
Gene: ENSMUSG00000029521
AA Change: Y127D

Domain	Start	End	E-Value	Type
low complexity region	2	37	N/A	INTRINSIC
low complexity region	41	72	N/A	INTRINSIC
FHA	116	179	5.14e-3	SMART
S_TKc	224	490	7.35e-104	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000199937
AA Change: Y127D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143558
Gene: ENSMUSG00000029521
AA Change: Y127D

Domain	Start	End	E-Value	Type
low complexity region	2	37	N/A	INTRINSIC
low complexity region	41	72	N/A	INTRINSIC
FHA	116	179	2.6e-5	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical cell cycle regulators. The protein encoded by this gene is a cell cycle checkpoint regulator and putative tumor suppressor. It contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis, and has been shown to stabilize the tumor suppressor protein p53, leading to cell cycle arrest in G1. In addition, this protein interacts with and phosphorylates BRCA1, allowing BRCA1 to restore survival after DNA damage. Mutations in this gene have been linked with Li-Fraumeni syndrome, a highly penetrant familial cancer phenotype usually associated with inherited mutations in TP53. Also, mutations in this gene are thought to confer a predisposition to sarcomas, breast cancer, and brain tumors. This nuclear protein is a member of the CDS1 subfamily of serine/threonine protein kinases. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous mutation of this gene does not increase tumor incidence. Cells from the thymus, central nervous system (CNS), hair follicles, and skin are resistant to ionizing radiation- and gamma irradiation-induced apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N01Rik	T	C	10: 21,497,578 (GRCm39)	L73P	probably damaging	Het
4933412E24Rik	T	G	15: 59,887,524 (GRCm39)	R305S	probably damaging	Het
Adamts19	T	A	18: 58,970,920 (GRCm39)	V168E	probably damaging	Het
Ankrd34b	T	A	13: 92,576,097 (GRCm39)	L443Q	probably damaging	Het
Ano3	A	G	2: 110,491,616 (GRCm39)	Y887H	probably damaging	Het
Arhgef2	A	T	3: 88,546,739 (GRCm39)	H553L	probably benign	Het
Atxn1	G	T	13: 45,720,505 (GRCm39)	N463K	probably benign	Het
Birc6	A	G	17: 74,932,099 (GRCm39)		probably null	Het
C4bp	A	G	1: 130,564,482 (GRCm39)	S401P	probably damaging	Het
Cd5	T	A	19: 10,697,609 (GRCm39)	R457W	probably damaging	Het
Clec4a1	G	A	6: 122,898,960 (GRCm39)	V10M	probably damaging	Het
Cltc	A	G	11: 86,603,457 (GRCm39)	Y790H	probably damaging	Het
Cops2	T	C	2: 125,701,028 (GRCm39)		probably benign	Het
Cyb5d2	A	G	11: 72,679,929 (GRCm39)	F122S	probably damaging	Het
Daam1	T	A	12: 71,998,689 (GRCm39)	L548H	unknown	Het
Dcp1a	A	G	14: 30,244,883 (GRCm39)	T570A	possibly damaging	Het
Dsg1a	A	C	18: 20,465,090 (GRCm39)	N427T	probably benign	Het
Ear14	A	T	14: 51,441,564 (GRCm39)	D140V	probably damaging	Het
Epha4	A	C	1: 77,483,547 (GRCm39)	F154C	probably damaging	Het
Ets2	G	A	16: 95,507,321 (GRCm39)	V12M	probably damaging	Het
Fbxo40	G	A	16: 36,789,670 (GRCm39)	T480I	probably damaging	Het
Fdps	A	T	3: 89,001,048 (GRCm39)	Y322N	probably damaging	Het
Gca	T	C	2: 62,516,700 (GRCm39)	M132T	probably benign	Het
Ifi203	T	G	1: 173,765,496 (GRCm39)	K26T	probably damaging	Het
Itga10	A	G	3: 96,562,116 (GRCm39)	R668G	probably damaging	Het
Itgal	T	C	7: 126,929,638 (GRCm39)	I1185T	unknown	Het
Kcnj13	A	T	1: 87,314,189 (GRCm39)	N344K	probably damaging	Het
Kdm5a	A	T	6: 120,358,516 (GRCm39)	L186F	probably benign	Het
Klhl8	T	C	5: 104,010,954 (GRCm39)	N624D	probably benign	Het
Klrb1	G	T	6: 128,689,222 (GRCm39)	T83K	possibly damaging	Het
Krt77	TGCCGCCGCCGCCGCCGCCGCCGCCGC	TGCCGCCGCCGCCGCCGCCGCCGC	15: 101,768,407 (GRCm39)		probably benign	Het
Ltb	G	T	17: 35,413,655 (GRCm39)	R53L	probably benign	Het
Mterf3	A	G	13: 67,055,222 (GRCm39)	V69A		Het
Mvb12a	A	G	8: 71,997,888 (GRCm39)	K101E	probably damaging	Het
Nbeal2	T	A	9: 110,464,409 (GRCm39)	Q1110L	possibly damaging	Het
Neb	T	A	2: 52,198,775 (GRCm39)	T389S	possibly damaging	Het
Nol4	A	G	18: 23,173,069 (GRCm39)	F11L	probably damaging	Het
Or10p22	T	C	10: 128,826,708 (GRCm39)	L309P	possibly damaging	Het
Or2a54	A	G	6: 43,093,440 (GRCm39)	I255V	probably benign	Het
Or2h15	A	G	17: 38,441,484 (GRCm39)	S200P	probably damaging	Het
Or52e8b	C	T	7: 104,673,885 (GRCm39)	G97R	probably benign	Het
Pde2a	T	A	7: 101,153,880 (GRCm39)	Y487N	possibly damaging	Het
Pde4a	C	T	9: 21,077,404 (GRCm39)	P61S	possibly damaging	Het
Pramel16	T	A	4: 143,675,690 (GRCm39)	T379S	probably benign	Het
Prr5l	A	G	2: 101,571,630 (GRCm39)		probably null	Het
Ptpn6	G	A	6: 124,705,614 (GRCm39)	T179I	possibly damaging	Het
Ralyl	T	C	3: 14,104,836 (GRCm39)	S34P	probably benign	Het
Rftn1	G	T	17: 50,354,408 (GRCm39)	A318D	probably damaging	Het
Robo2	A	T	16: 73,812,814 (GRCm39)	C293*	probably null	Het
Rtn4	T	G	11: 29,655,536 (GRCm39)	D169E	probably damaging	Het
Slc22a22	A	T	15: 57,122,506 (GRCm39)	V157E	probably damaging	Het
Sytl2	A	G	7: 90,034,283 (GRCm39)	T498A	probably benign	Het
Tgm6	G	A	2: 129,979,358 (GRCm39)	V163I	probably benign	Het
Tnpo3	A	T	6: 29,582,302 (GRCm39)	C187S	possibly damaging	Het
Ttn	A	G	2: 76,616,485 (GRCm39)		probably null	Het
Tut4	G	A	4: 108,336,905 (GRCm39)	A210T	possibly damaging	Het
Vangl2	C	A	1: 171,837,513 (GRCm39)	V99F	possibly damaging	Het
Vmn1r167	C	T	7: 23,204,215 (GRCm39)	C267Y	probably damaging	Het
Vsig10l	T	C	7: 43,113,531 (GRCm39)	V161A	possibly damaging	Het
Xrcc5	G	A	1: 72,364,244 (GRCm39)	R232Q	possibly damaging	Het
Xrcc6	C	G	15: 81,913,463 (GRCm39)	F365L	probably damaging	Het
Zdhhc13	A	G	7: 48,465,257 (GRCm39)	Y389C	probably damaging	Het

Other mutations in Chek2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01025:Chek2	APN	5	110,996,536 (GRCm39)	missense	probably damaging	1.00
IGL01830:Chek2	APN	5	111,021,374 (GRCm39)	missense	probably benign
IGL01943:Chek2	APN	5	110,989,093 (GRCm39)	unclassified	probably benign
IGL02319:Chek2	APN	5	111,014,877 (GRCm39)	missense	possibly damaging	0.88
IGL03147:Chek2	UTSW	5	110,996,536 (GRCm39)	missense	probably damaging	1.00
PIT4520001:Chek2	UTSW	5	111,011,195 (GRCm39)	missense	probably damaging	1.00
R1484:Chek2	UTSW	5	110,996,553 (GRCm39)	missense	probably damaging	1.00
R1486:Chek2	UTSW	5	110,989,093 (GRCm39)	unclassified	probably benign
R1732:Chek2	UTSW	5	111,019,968 (GRCm39)	missense	probably benign	0.26
R2041:Chek2	UTSW	5	110,996,530 (GRCm39)	missense	probably damaging	1.00
R2071:Chek2	UTSW	5	110,989,112 (GRCm39)	unclassified	probably benign
R2873:Chek2	UTSW	5	111,011,202 (GRCm39)	nonsense	probably null
R2935:Chek2	UTSW	5	111,015,886 (GRCm39)	missense	probably damaging	1.00
R3899:Chek2	UTSW	5	111,013,479 (GRCm39)	splice site	probably benign
R4662:Chek2	UTSW	5	111,014,908 (GRCm39)	missense	probably damaging	1.00
R4748:Chek2	UTSW	5	111,003,705 (GRCm39)	splice site	probably null
R5358:Chek2	UTSW	5	110,989,148 (GRCm39)	unclassified	probably benign
R5582:Chek2	UTSW	5	111,015,901 (GRCm39)	missense	probably damaging	0.96
R5594:Chek2	UTSW	5	111,003,700 (GRCm39)	critical splice donor site	probably null
R6526:Chek2	UTSW	5	110,996,556 (GRCm39)	missense	probably damaging	1.00
R6972:Chek2	UTSW	5	111,003,705 (GRCm39)	splice site	probably null
R7232:Chek2	UTSW	5	111,008,781 (GRCm39)	missense	probably damaging	1.00
R7338:Chek2	UTSW	5	111,021,380 (GRCm39)	missense	probably benign
R7395:Chek2	UTSW	5	111,019,974 (GRCm39)	critical splice donor site	probably null
R7714:Chek2	UTSW	5	110,989,319 (GRCm39)	missense	probably benign	0.10
R7743:Chek2	UTSW	5	110,987,916 (GRCm39)	critical splice donor site	probably null
R8290:Chek2	UTSW	5	111,008,766 (GRCm39)	missense	possibly damaging	0.70
R8719:Chek2	UTSW	5	111,014,908 (GRCm39)	missense	probably damaging	0.98
R8898:Chek2	UTSW	5	111,011,175 (GRCm39)	missense	probably benign	0.00
R8906:Chek2	UTSW	5	111,013,458 (GRCm39)	utr 3 prime	probably benign

Predicted Primers

PCR Primer
(F):5'- TGACAGTGTCTTTCTTGTAGGCAAG -3'
(R):5'- ACGAAGGTTCCATTTCCACTG -3'

Sequencing Primer
(F):5'- AGGCAAGTCTCTTAAGCTTGTC -3'
(R):5'- TTAGGGCCCATTTCCTAAAACAGAG -3'

Posted On

2020-07-28