Incidental Mutation 'R8297:Zdhhc13'
ID639017
Institutional Source Beutler Lab
Gene Symbol Zdhhc13
Ensembl Gene ENSMUSG00000030471
Gene Namezinc finger, DHHC domain containing 13
Synonymskojak, Hip14l, skc4, 2410004E01Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8297 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location48789003-48827440 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48815509 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 389 (Y389C)
Ref Sequence ENSEMBL: ENSMUSP00000112498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118927] [ENSMUST00000125280]
Predicted Effect probably damaging
Transcript: ENSMUST00000118927
AA Change: Y389C

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112498
Gene: ENSMUSG00000030471
AA Change: Y389C

DomainStartEndE-ValueType
Blast:ANK 48 77 1e-9 BLAST
ANK 81 110 3.08e-1 SMART
ANK 115 144 4.39e-6 SMART
ANK 148 177 2.37e-2 SMART
ANK 181 211 5.19e2 SMART
ANK 216 245 8.07e-5 SMART
ANK 249 277 1.09e3 SMART
transmembrane domain 292 310 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 344 366 N/A INTRINSIC
transmembrane domain 373 392 N/A INTRINSIC
Pfam:zf-DHHC 421 558 1.1e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125280
AA Change: Y259C

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123603
Gene: ENSMUSG00000030471
AA Change: Y259C

DomainStartEndE-ValueType
ANK 18 47 2.37e-2 SMART
ANK 51 81 5.19e2 SMART
ANK 86 115 8.07e-5 SMART
ANK 119 147 1.09e3 SMART
transmembrane domain 160 182 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
Pfam:zf-DHHC 258 428 1.1e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutation display wasting, weight loss, hair loss (alopecia), reduced bone mineral density (osteoporosis), and generalized amyloid deposition, which resulted in early death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T C 10: 21,621,679 L73P probably damaging Het
4933412E24Rik T G 15: 60,015,675 R305S probably damaging Het
Adamts19 T A 18: 58,837,848 V168E probably damaging Het
Ankrd34b T A 13: 92,439,589 L443Q probably damaging Het
Ano3 A G 2: 110,661,271 Y887H probably damaging Het
Arhgef2 A T 3: 88,639,432 H553L probably benign Het
Atxn1 G T 13: 45,567,029 N463K probably benign Het
Birc6 A G 17: 74,625,104 probably null Het
C4bp A G 1: 130,636,745 S401P probably damaging Het
Cd5 T A 19: 10,720,245 R457W probably damaging Het
Chek2 T G 5: 110,848,436 Y127D probably damaging Het
Clec4a1 G A 6: 122,922,001 V10M probably damaging Het
Cltc A G 11: 86,712,631 Y790H probably damaging Het
Cops2 T C 2: 125,859,108 probably benign Het
Cyb5d2 A G 11: 72,789,103 F122S probably damaging Het
Daam1 T A 12: 71,951,915 L548H unknown Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dsg1a A C 18: 20,332,033 N427T probably benign Het
Ear14 A T 14: 51,204,107 D140V probably damaging Het
Epha4 A C 1: 77,506,910 F154C probably damaging Het
Ets2 G A 16: 95,706,454 V12M probably damaging Het
Fbxo40 G A 16: 36,969,308 T480I probably damaging Het
Fdps A T 3: 89,093,741 Y322N probably damaging Het
Gca T C 2: 62,686,356 M132T probably benign Het
Ifi203 T G 1: 173,937,930 K26T probably damaging Het
Itga10 A G 3: 96,654,800 R668G probably damaging Het
Itgal T C 7: 127,330,466 I1185T unknown Het
Kcnj13 A T 1: 87,386,467 N344K probably damaging Het
Kdm5a A T 6: 120,381,555 L186F probably benign Het
Klhl8 T C 5: 103,863,088 N624D probably benign Het
Klrb1 G T 6: 128,712,259 T83K possibly damaging Het
Krt77 TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 15: 101,859,972 probably benign Het
Ltb G T 17: 35,194,679 R53L probably benign Het
Mterf3 A G 13: 66,907,158 V69A Het
Mvb12a A G 8: 71,545,244 K101E probably damaging Het
Nbeal2 T A 9: 110,635,341 Q1110L possibly damaging Het
Neb T A 2: 52,308,763 T389S possibly damaging Het
Nol4 A G 18: 23,040,012 F11L probably damaging Het
Olfr132 A G 17: 38,130,593 S200P probably damaging Het
Olfr441 A G 6: 43,116,506 I255V probably benign Het
Olfr675 C T 7: 105,024,678 G97R probably benign Het
Olfr9 T C 10: 128,990,839 L309P possibly damaging Het
Pde2a T A 7: 101,504,673 Y487N possibly damaging Het
Pde4a C T 9: 21,166,108 P61S possibly damaging Het
Pramef25 T A 4: 143,949,120 T379S probably benign Het
Prr5l A G 2: 101,741,285 probably null Het
Ptpn6 G A 6: 124,728,651 T179I possibly damaging Het
Ralyl T C 3: 14,039,776 S34P probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Robo2 A T 16: 74,015,926 C293* probably null Het
Rtn4 T G 11: 29,705,536 D169E probably damaging Het
Slc22a22 A T 15: 57,259,110 V157E probably damaging Het
Sytl2 A G 7: 90,385,075 T498A probably benign Het
Tgm6 G A 2: 130,137,438 V163I probably benign Het
Tnpo3 A T 6: 29,582,303 C187S possibly damaging Het
Ttn A G 2: 76,786,141 probably null Het
Vangl2 C A 1: 172,009,946 V99F possibly damaging Het
Vmn1r167 C T 7: 23,504,790 C267Y probably damaging Het
Vsig10l T C 7: 43,464,107 V161A possibly damaging Het
Xrcc5 G A 1: 72,325,085 R232Q possibly damaging Het
Xrcc6 C G 15: 82,029,262 F365L probably damaging Het
Zcchc11 G A 4: 108,479,708 A210T possibly damaging Het
Other mutations in Zdhhc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00852:Zdhhc13 APN 7 48805601 missense probably benign 0.00
IGL01820:Zdhhc13 APN 7 48808865 missense probably damaging 1.00
IGL02941:Zdhhc13 APN 7 48817138 splice site probably benign
bernard UTSW 7 48826873 missense probably damaging 1.00
brindle UTSW 7 48824731 missense possibly damaging 0.47
oxidized UTSW 7 48816427 missense probably benign 0.04
rusty UTSW 7 48824644 missense possibly damaging 0.95
zephiro UTSW 7 48811355 nonsense probably null
PIT4445001:Zdhhc13 UTSW 7 48795949 missense probably benign 0.00
R0456:Zdhhc13 UTSW 7 48808854 missense probably benign 0.03
R1398:Zdhhc13 UTSW 7 48826873 missense probably damaging 1.00
R1785:Zdhhc13 UTSW 7 48824644 missense possibly damaging 0.95
R1786:Zdhhc13 UTSW 7 48824644 missense possibly damaging 0.95
R2066:Zdhhc13 UTSW 7 48816427 missense probably benign 0.04
R2131:Zdhhc13 UTSW 7 48824644 missense possibly damaging 0.95
R2133:Zdhhc13 UTSW 7 48824644 missense possibly damaging 0.95
R2405:Zdhhc13 UTSW 7 48822730 splice site probably null
R3770:Zdhhc13 UTSW 7 48802944 missense probably damaging 1.00
R4374:Zdhhc13 UTSW 7 48808841 missense probably damaging 1.00
R4772:Zdhhc13 UTSW 7 48799873 missense probably benign 0.24
R5052:Zdhhc13 UTSW 7 48824731 missense possibly damaging 0.47
R5455:Zdhhc13 UTSW 7 48805575 missense possibly damaging 0.95
R6418:Zdhhc13 UTSW 7 48811401 missense possibly damaging 0.94
R6502:Zdhhc13 UTSW 7 48815560 missense possibly damaging 0.95
R7136:Zdhhc13 UTSW 7 48801332 missense probably benign
R7467:Zdhhc13 UTSW 7 48804408 missense probably benign 0.02
R7485:Zdhhc13 UTSW 7 48811355 nonsense probably null
R7723:Zdhhc13 UTSW 7 48808819 missense probably benign
R8356:Zdhhc13 UTSW 7 48802999 missense probably damaging 1.00
R8385:Zdhhc13 UTSW 7 48805696 critical splice donor site probably null
R8456:Zdhhc13 UTSW 7 48802999 missense probably damaging 1.00
X0021:Zdhhc13 UTSW 7 48805215 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GAGCAGACTCTGTAGGATCAGAAC -3'
(R):5'- CATTTTGATGATCTAATCTGCCCAC -3'

Sequencing Primer
(F):5'- CTCTGTAGGATCAGAACATGGAAG -3'
(R):5'- AATCTGCCCACATTTTATGTTGTAC -3'
Posted On2020-07-28