Mutagenetix > Incidental Mutation

Incidental Mutation 'R0697:Cpsf2'

63902

Institutional Source

Beutler Lab

Gene Symbol

Cpsf2

Ensembl Gene

ENSMUSG00000041781

Gene Name

cleavage and polyadenylation specific factor 2

Synonyms

100kDa, 2610024B04Rik, Cpsf

MMRRC Submission

038881-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R0697 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

101975988-102006424 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101983184 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 53 (H53R)

Ref Sequence

ENSEMBL: ENSMUSP00000047797 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047357]

AlphaFold

O35218

Predicted Effect

probably benign
Transcript: ENSMUST00000047357
AA Change: H53R

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000047797
Gene: ENSMUSG00000041781
AA Change: H53R

Domain	Start	End	E-Value	Type
Lactamase_B	17	223	5.22e-1	SMART
Beta-Casp	243	368	1.8e-21	SMART
coiled coil region	380	418	N/A	INTRINSIC
Pfam:RMMBL	527	569	1.2e-14	PFAM
Pfam:CPSF100_C	608	779	5.7e-46	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1cf	C	A	19: 31,911,167	A99E	probably damaging	Het
Aig1	T	C	10: 13,829,325	N72S	probably benign	Het
Atad2	T	C	15: 58,105,543	I857M	possibly damaging	Het
Ceacam15	A	C	7: 16,673,520	L24*	probably null	Het
Crh	C	A	3: 19,694,077	G134C	probably damaging	Het
Cyp2g1	A	T	7: 26,814,727	K253*	probably null	Het
Dna2	T	C	10: 62,949,341	V79A	probably benign	Het
Dsc2	A	G	18: 20,041,452	V549A	probably damaging	Het
Etl4	G	T	2: 20,743,861	V135F	probably damaging	Het
Frk	A	G	10: 34,607,837	H398R	probably benign	Het
Gfra1	A	C	19: 58,270,123	S271A	probably benign	Het
Htr1b	T	C	9: 81,631,463	I364V	possibly damaging	Het
Kcnh5	A	T	12: 74,976,531	C588S	possibly damaging	Het
Kif13a	G	A	13: 46,848,337	T70I	probably benign	Het
Klra6	T	C	6: 130,016,724	I195V	probably benign	Het
Nras	T	C	3: 103,060,300	Y71H	possibly damaging	Het
Sirt5	T	C	13: 43,385,576	F274L	probably damaging	Het
Synj1	T	C	16: 90,960,615	T882A	probably benign	Het
Vmn1r84	A	T	7: 12,362,763	M1K	probably null	Het
Zfhx4	A	T	3: 5,401,733	E2317V	probably damaging	Het
Zfp345	A	T	2: 150,472,909	I236K	probably benign	Het

Other mutations in Cpsf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00737:Cpsf2	APN	12	101983466	missense	probably damaging	1.00
IGL01114:Cpsf2	APN	12	101989839	missense	possibly damaging	0.93
IGL01121:Cpsf2	APN	12	101988706	missense	probably damaging	1.00
IGL01377:Cpsf2	APN	12	101987381	splice site	probably null
IGL01465:Cpsf2	APN	12	101997333	missense	probably damaging	1.00
IGL02861:Cpsf2	APN	12	101999566	missense	probably benign	0.00
R0469:Cpsf2	UTSW	12	101988786	missense	probably damaging	1.00
R0504:Cpsf2	UTSW	12	101990003	missense	probably damaging	1.00
R0510:Cpsf2	UTSW	12	101988786	missense	probably damaging	1.00
R0626:Cpsf2	UTSW	12	101985231	missense	probably benign	0.09
R0837:Cpsf2	UTSW	12	101997242	splice site	probably benign
R1475:Cpsf2	UTSW	12	101985236	missense	probably damaging	1.00
R1709:Cpsf2	UTSW	12	101999542	missense	probably damaging	1.00
R1974:Cpsf2	UTSW	12	101990047	missense	probably benign	0.33
R1996:Cpsf2	UTSW	12	101998608	missense	probably benign	0.18
R2063:Cpsf2	UTSW	12	101983463	missense	probably damaging	1.00
R2164:Cpsf2	UTSW	12	101985335	missense	probably damaging	1.00
R2228:Cpsf2	UTSW	12	101989829	missense	probably benign	0.00
R3082:Cpsf2	UTSW	12	101988810	missense	probably damaging	0.99
R3732:Cpsf2	UTSW	12	101987308	missense	probably damaging	0.99
R3732:Cpsf2	UTSW	12	101987308	missense	probably damaging	0.99
R3733:Cpsf2	UTSW	12	101987308	missense	probably damaging	0.99
R4627:Cpsf2	UTSW	12	101989895	missense	probably benign	0.18
R4665:Cpsf2	UTSW	12	101983207	missense	probably damaging	1.00
R4666:Cpsf2	UTSW	12	101983207	missense	probably damaging	1.00
R4765:Cpsf2	UTSW	12	101997440	missense	probably damaging	1.00
R4777:Cpsf2	UTSW	12	101996832	missense	probably damaging	0.99
R4847:Cpsf2	UTSW	12	101997302	missense	probably benign	0.18
R4923:Cpsf2	UTSW	12	101981984	missense	probably benign
R4975:Cpsf2	UTSW	12	101983493	missense	probably damaging	1.00
R5239:Cpsf2	UTSW	12	101987273	nonsense	probably null
R5440:Cpsf2	UTSW	12	101996879	missense	probably benign
R5601:Cpsf2	UTSW	12	101985355	splice site	probably null
R5603:Cpsf2	UTSW	12	101998631	missense	probably benign	0.02
R5841:Cpsf2	UTSW	12	101985238	missense	probably damaging	0.99
R6153:Cpsf2	UTSW	12	101999360	splice site	probably null
R6663:Cpsf2	UTSW	12	101999593	missense	probably damaging	1.00
R7451:Cpsf2	UTSW	12	102000792	missense	possibly damaging	0.52
R8357:Cpsf2	UTSW	12	102002670	missense	probably damaging	0.99
R8457:Cpsf2	UTSW	12	102002670	missense	probably damaging	0.99
R9123:Cpsf2	UTSW	12	101997296	missense	probably damaging	0.96
R9433:Cpsf2	UTSW	12	101981993	missense	probably damaging	1.00
V8831:Cpsf2	UTSW	12	102003141	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGGAGTCATTGCATTAGCCCTTG -3'
(R):5'- TGTCAAAGGCTGCATCCACATCATC -3'

Sequencing Primer
(F):5'- CATTAGCCCTTGGGTTTGC -3'
(R):5'- TCCACATCATCCAATGTAAAGAGGG -3'

Posted On

2013-07-30