Incidental Mutation 'R0697:Cpsf2'
ID63902
Institutional Source Beutler Lab
Gene Symbol Cpsf2
Ensembl Gene ENSMUSG00000041781
Gene Namecleavage and polyadenylation specific factor 2
Synonyms100kDa, 2610024B04Rik, Cpsf
MMRRC Submission 038881-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R0697 (G1)
Quality Score84
Status Not validated
Chromosome12
Chromosomal Location101975988-102006424 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101983184 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 53 (H53R)
Ref Sequence ENSEMBL: ENSMUSP00000047797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047357]
Predicted Effect probably benign
Transcript: ENSMUST00000047357
AA Change: H53R

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000047797
Gene: ENSMUSG00000041781
AA Change: H53R

DomainStartEndE-ValueType
Lactamase_B 17 223 5.22e-1 SMART
Beta-Casp 243 368 1.8e-21 SMART
coiled coil region 380 418 N/A INTRINSIC
Pfam:RMMBL 527 569 1.2e-14 PFAM
Pfam:CPSF100_C 608 779 5.7e-46 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C A 19: 31,911,167 A99E probably damaging Het
Aig1 T C 10: 13,829,325 N72S probably benign Het
Atad2 T C 15: 58,105,543 I857M possibly damaging Het
Ceacam15 A C 7: 16,673,520 L24* probably null Het
Crh C A 3: 19,694,077 G134C probably damaging Het
Cyp2g1 A T 7: 26,814,727 K253* probably null Het
Dna2 T C 10: 62,949,341 V79A probably benign Het
Dsc2 A G 18: 20,041,452 V549A probably damaging Het
Etl4 G T 2: 20,743,861 V135F probably damaging Het
Frk A G 10: 34,607,837 H398R probably benign Het
Gfra1 A C 19: 58,270,123 S271A probably benign Het
Htr1b T C 9: 81,631,463 I364V possibly damaging Het
Kcnh5 A T 12: 74,976,531 C588S possibly damaging Het
Kif13a G A 13: 46,848,337 T70I probably benign Het
Klra6 T C 6: 130,016,724 I195V probably benign Het
Nras T C 3: 103,060,300 Y71H possibly damaging Het
Sirt5 T C 13: 43,385,576 F274L probably damaging Het
Synj1 T C 16: 90,960,615 T882A probably benign Het
Vmn1r84 A T 7: 12,362,763 M1K probably null Het
Zfhx4 A T 3: 5,401,733 E2317V probably damaging Het
Zfp345 A T 2: 150,472,909 I236K probably benign Het
Other mutations in Cpsf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Cpsf2 APN 12 101983466 missense probably damaging 1.00
IGL01114:Cpsf2 APN 12 101989839 missense possibly damaging 0.93
IGL01121:Cpsf2 APN 12 101988706 missense probably damaging 1.00
IGL01377:Cpsf2 APN 12 101987381 splice site probably null
IGL01465:Cpsf2 APN 12 101997333 missense probably damaging 1.00
IGL02861:Cpsf2 APN 12 101999566 missense probably benign 0.00
R0469:Cpsf2 UTSW 12 101988786 missense probably damaging 1.00
R0504:Cpsf2 UTSW 12 101990003 missense probably damaging 1.00
R0510:Cpsf2 UTSW 12 101988786 missense probably damaging 1.00
R0626:Cpsf2 UTSW 12 101985231 missense probably benign 0.09
R0837:Cpsf2 UTSW 12 101997242 splice site probably benign
R1475:Cpsf2 UTSW 12 101985236 missense probably damaging 1.00
R1709:Cpsf2 UTSW 12 101999542 missense probably damaging 1.00
R1974:Cpsf2 UTSW 12 101990047 missense probably benign 0.33
R1996:Cpsf2 UTSW 12 101998608 missense probably benign 0.18
R2063:Cpsf2 UTSW 12 101983463 missense probably damaging 1.00
R2164:Cpsf2 UTSW 12 101985335 missense probably damaging 1.00
R2228:Cpsf2 UTSW 12 101989829 missense probably benign 0.00
R3082:Cpsf2 UTSW 12 101988810 missense probably damaging 0.99
R3732:Cpsf2 UTSW 12 101987308 missense probably damaging 0.99
R3732:Cpsf2 UTSW 12 101987308 missense probably damaging 0.99
R3733:Cpsf2 UTSW 12 101987308 missense probably damaging 0.99
R4627:Cpsf2 UTSW 12 101989895 missense probably benign 0.18
R4665:Cpsf2 UTSW 12 101983207 missense probably damaging 1.00
R4666:Cpsf2 UTSW 12 101983207 missense probably damaging 1.00
R4765:Cpsf2 UTSW 12 101997440 missense probably damaging 1.00
R4777:Cpsf2 UTSW 12 101996832 missense probably damaging 0.99
R4847:Cpsf2 UTSW 12 101997302 missense probably benign 0.18
R4923:Cpsf2 UTSW 12 101981984 missense probably benign
R4975:Cpsf2 UTSW 12 101983493 missense probably damaging 1.00
R5239:Cpsf2 UTSW 12 101987273 nonsense probably null
R5440:Cpsf2 UTSW 12 101996879 missense probably benign
R5601:Cpsf2 UTSW 12 101985355 splice site probably null
R5603:Cpsf2 UTSW 12 101998631 missense probably benign 0.02
R5841:Cpsf2 UTSW 12 101985238 missense probably damaging 0.99
R6153:Cpsf2 UTSW 12 101999360 splice site probably null
R6663:Cpsf2 UTSW 12 101999593 missense probably damaging 1.00
R7451:Cpsf2 UTSW 12 102000792 missense possibly damaging 0.52
R8357:Cpsf2 UTSW 12 102002670 missense probably damaging 0.99
R8457:Cpsf2 UTSW 12 102002670 missense probably damaging 0.99
V8831:Cpsf2 UTSW 12 102003141 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGAGTCATTGCATTAGCCCTTG -3'
(R):5'- TGTCAAAGGCTGCATCCACATCATC -3'

Sequencing Primer
(F):5'- CATTAGCCCTTGGGTTTGC -3'
(R):5'- TCCACATCATCCAATGTAAAGAGGG -3'
Posted On2013-07-30