Incidental Mutation 'R8297:Pde4a'
ID639023
Institutional Source Beutler Lab
Gene Symbol Pde4a
Ensembl Gene ENSMUSG00000032177
Gene Namephosphodiesterase 4A, cAMP specific
SynonymsDpde2, dunce, D9Ertd60e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R8297 (G1)
Quality Score211.009
Status Not validated
Chromosome9
Chromosomal Location21165714-21213248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21166108 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 61 (P61S)
Ref Sequence ENSEMBL: ENSMUSP00000037025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039413]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039413
AA Change: P61S

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037025
Gene: ENSMUSG00000032177
AA Change: P61S

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
low complexity region 92 102 N/A INTRINSIC
low complexity region 296 321 N/A INTRINSIC
HDc 416 591 7.12e-5 SMART
low complexity region 696 709 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE4 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygous null mice have a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T C 10: 21,621,679 L73P probably damaging Het
4933412E24Rik T G 15: 60,015,675 R305S probably damaging Het
Adamts19 T A 18: 58,837,848 V168E probably damaging Het
Ankrd34b T A 13: 92,439,589 L443Q probably damaging Het
Ano3 A G 2: 110,661,271 Y887H probably damaging Het
Arhgef2 A T 3: 88,639,432 H553L probably benign Het
Atxn1 G T 13: 45,567,029 N463K probably benign Het
Birc6 A G 17: 74,625,104 probably null Het
C4bp A G 1: 130,636,745 S401P probably damaging Het
Cd5 T A 19: 10,720,245 R457W probably damaging Het
Chek2 T G 5: 110,848,436 Y127D probably damaging Het
Clec4a1 G A 6: 122,922,001 V10M probably damaging Het
Cltc A G 11: 86,712,631 Y790H probably damaging Het
Cops2 T C 2: 125,859,108 probably benign Het
Cyb5d2 A G 11: 72,789,103 F122S probably damaging Het
Daam1 T A 12: 71,951,915 L548H unknown Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dsg1a A C 18: 20,332,033 N427T probably benign Het
Ear14 A T 14: 51,204,107 D140V probably damaging Het
Epha4 A C 1: 77,506,910 F154C probably damaging Het
Ets2 G A 16: 95,706,454 V12M probably damaging Het
Fbxo40 G A 16: 36,969,308 T480I probably damaging Het
Fdps A T 3: 89,093,741 Y322N probably damaging Het
Gca T C 2: 62,686,356 M132T probably benign Het
Ifi203 T G 1: 173,937,930 K26T probably damaging Het
Itga10 A G 3: 96,654,800 R668G probably damaging Het
Itgal T C 7: 127,330,466 I1185T unknown Het
Kcnj13 A T 1: 87,386,467 N344K probably damaging Het
Kdm5a A T 6: 120,381,555 L186F probably benign Het
Klhl8 T C 5: 103,863,088 N624D probably benign Het
Klrb1 G T 6: 128,712,259 T83K possibly damaging Het
Krt77 TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 15: 101,859,972 probably benign Het
Ltb G T 17: 35,194,679 R53L probably benign Het
Mterf3 A G 13: 66,907,158 V69A Het
Mvb12a A G 8: 71,545,244 K101E probably damaging Het
Nbeal2 T A 9: 110,635,341 Q1110L possibly damaging Het
Neb T A 2: 52,308,763 T389S possibly damaging Het
Nol4 A G 18: 23,040,012 F11L probably damaging Het
Olfr132 A G 17: 38,130,593 S200P probably damaging Het
Olfr441 A G 6: 43,116,506 I255V probably benign Het
Olfr675 C T 7: 105,024,678 G97R probably benign Het
Olfr9 T C 10: 128,990,839 L309P possibly damaging Het
Pde2a T A 7: 101,504,673 Y487N possibly damaging Het
Pramef25 T A 4: 143,949,120 T379S probably benign Het
Prr5l A G 2: 101,741,285 probably null Het
Ptpn6 G A 6: 124,728,651 T179I possibly damaging Het
Ralyl T C 3: 14,039,776 S34P probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Robo2 A T 16: 74,015,926 C293* probably null Het
Rtn4 T G 11: 29,705,536 D169E probably damaging Het
Slc22a22 A T 15: 57,259,110 V157E probably damaging Het
Sytl2 A G 7: 90,385,075 T498A probably benign Het
Tgm6 G A 2: 130,137,438 V163I probably benign Het
Tnpo3 A T 6: 29,582,303 C187S possibly damaging Het
Ttn A G 2: 76,786,141 probably null Het
Vangl2 C A 1: 172,009,946 V99F possibly damaging Het
Vmn1r167 C T 7: 23,504,790 C267Y probably damaging Het
Vsig10l T C 7: 43,464,107 V161A possibly damaging Het
Xrcc5 G A 1: 72,325,085 R232Q possibly damaging Het
Xrcc6 C G 15: 82,029,262 F365L probably damaging Het
Zcchc11 G A 4: 108,479,708 A210T possibly damaging Het
Zdhhc13 A G 7: 48,815,509 Y389C probably damaging Het
Other mutations in Pde4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pde4a APN 9 21211061 missense probably benign 0.01
IGL01330:Pde4a APN 9 21192438 splice site probably benign
IGL01403:Pde4a APN 9 21205116 missense probably damaging 1.00
IGL01610:Pde4a APN 9 21211350 utr 3 prime probably benign
IGL02010:Pde4a APN 9 21203554 critical splice donor site probably null
IGL02296:Pde4a APN 9 21192569 missense possibly damaging 0.94
IGL02637:Pde4a APN 9 21201332 missense probably damaging 0.97
PIT4696001:Pde4a UTSW 9 21211001 missense probably benign
R0032:Pde4a UTSW 9 21201432 splice site probably benign
R0032:Pde4a UTSW 9 21201432 splice site probably benign
R0257:Pde4a UTSW 9 21192421 missense probably damaging 1.00
R0504:Pde4a UTSW 9 21204403 missense probably damaging 1.00
R1437:Pde4a UTSW 9 21192592 critical splice donor site probably null
R1524:Pde4a UTSW 9 21201247 missense probably damaging 0.98
R1750:Pde4a UTSW 9 21203232 missense probably damaging 1.00
R2239:Pde4a UTSW 9 21211268 missense probably damaging 1.00
R2905:Pde4a UTSW 9 21201349 missense probably benign 0.01
R2991:Pde4a UTSW 9 21203243 missense probably damaging 0.96
R3972:Pde4a UTSW 9 21206217 missense probably damaging 1.00
R4826:Pde4a UTSW 9 21192380 splice site probably null
R4922:Pde4a UTSW 9 21210713 missense probably damaging 1.00
R5195:Pde4a UTSW 9 21204333 missense possibly damaging 0.70
R5208:Pde4a UTSW 9 21203558 splice site probably null
R5552:Pde4a UTSW 9 21201386 missense probably damaging 1.00
R5713:Pde4a UTSW 9 21203517 missense probably damaging 1.00
R6722:Pde4a UTSW 9 21211225 missense probably damaging 1.00
R6792:Pde4a UTSW 9 21192590 missense probably benign 0.03
R6861:Pde4a UTSW 9 21205301 missense probably damaging 1.00
R6901:Pde4a UTSW 9 21204970 missense probably benign 0.37
R7300:Pde4a UTSW 9 21206322 missense probably damaging 1.00
R7690:Pde4a UTSW 9 21166004 missense probably damaging 1.00
R7798:Pde4a UTSW 9 21198663 missense possibly damaging 0.63
R8073:Pde4a UTSW 9 21210769 missense probably damaging 1.00
R8133:Pde4a UTSW 9 21191377 missense possibly damaging 0.87
R8167:Pde4a UTSW 9 21206173 missense possibly damaging 0.95
R8348:Pde4a UTSW 9 21206238 missense probably benign 0.35
R8448:Pde4a UTSW 9 21206238 missense probably benign 0.35
X0027:Pde4a UTSW 9 21198654 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGCCAGGGGACGTTTT -3'
(R):5'- AAAGGGCTTCTGGTGCAG -3'

Sequencing Primer
(F):5'- ACGTTTTTGCCCCCGGG -3'
(R):5'- TTTGGCCAGCATTGCGC -3'
Posted On2020-07-28