Incidental Mutation 'R8297:Nbeal2'
ID639024
Institutional Source Beutler Lab
Gene Symbol Nbeal2
Ensembl Gene ENSMUSG00000056724
Gene Nameneurobeachin-like 2
Synonyms1110014F23Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R8297 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location110624789-110654161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110635341 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1110 (Q1110L)
Ref Sequence ENSEMBL: ENSMUSP00000128586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133191] [ENSMUST00000149089] [ENSMUST00000167320] [ENSMUST00000196488]
Predicted Effect probably benign
Transcript: ENSMUST00000123996
Predicted Effect
SMART Domains Protein: ENSMUSP00000118061
Gene: ENSMUSG00000056724
AA Change: Q582L

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
low complexity region 236 248 N/A INTRINSIC
Pfam:DUF4704 345 607 2.5e-29 PFAM
low complexity region 649 664 N/A INTRINSIC
low complexity region 804 819 N/A INTRINSIC
Pfam:DUF4800 872 1138 9.9e-113 PFAM
low complexity region 1164 1193 N/A INTRINSIC
Pfam:PH_BEACH 1204 1291 2.2e-21 PFAM
Beach 1343 1623 5.2e-205 SMART
WD40 1721 1766 1.03e1 SMART
WD40 1769 1808 6.19e-5 SMART
WD40 1820 1859 1.02e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131017
SMART Domains Protein: ENSMUSP00000114660
Gene: ENSMUSG00000056724

DomainStartEndE-ValueType
Pfam:DUF4800 1 209 7.5e-97 PFAM
low complexity region 235 264 N/A INTRINSIC
Pfam:PH_BEACH 275 362 1e-21 PFAM
Beach 414 694 5.2e-205 SMART
WD40 762 807 1.03e1 SMART
WD40 810 849 6.19e-5 SMART
WD40 861 900 1.02e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133191
AA Change: Q1110L

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000121373
Gene: ENSMUSG00000056724
AA Change: Q1110L

DomainStartEndE-ValueType
low complexity region 56 84 N/A INTRINSIC
low complexity region 192 201 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
Pfam:Laminin_G_3 578 818 5.9e-8 PFAM
low complexity region 1014 1028 N/A INTRINSIC
low complexity region 1128 1136 N/A INTRINSIC
low complexity region 1149 1163 N/A INTRINSIC
low complexity region 1359 1375 N/A INTRINSIC
low complexity region 1515 1530 N/A INTRINSIC
low complexity region 1621 1647 N/A INTRINSIC
low complexity region 1875 1904 N/A INTRINSIC
Pfam:PH_BEACH 1908 2002 6.2e-28 PFAM
Beach 2054 2334 5.2e-205 SMART
WD40 2432 2477 1.03e1 SMART
WD40 2480 2519 6.19e-5 SMART
WD40 2531 2570 1.02e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149089
SMART Domains Protein: ENSMUSP00000119254
Gene: ENSMUSG00000056724

DomainStartEndE-ValueType
low complexity region 49 77 N/A INTRINSIC
low complexity region 185 194 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
low complexity region 480 488 N/A INTRINSIC
low complexity region 493 508 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167320
AA Change: Q1110L

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128586
Gene: ENSMUSG00000056724
AA Change: Q1110L

DomainStartEndE-ValueType
low complexity region 56 84 N/A INTRINSIC
low complexity region 192 201 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 763 775 N/A INTRINSIC
Pfam:DUF4704 872 1148 9.2e-32 PFAM
low complexity region 1149 1163 N/A INTRINSIC
low complexity region 1366 1382 N/A INTRINSIC
low complexity region 1522 1537 N/A INTRINSIC
Pfam:DUF4800 1590 1856 1.5e-112 PFAM
low complexity region 1882 1911 N/A INTRINSIC
Pfam:PH_BEACH 1922 2009 3.1e-21 PFAM
Beach 2061 2341 5.2e-205 SMART
WD40 2439 2484 1.03e1 SMART
WD40 2487 2526 6.19e-5 SMART
WD40 2538 2577 1.02e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000196488
AA Change: Q1083L

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143265
Gene: ENSMUSG00000056724
AA Change: Q1083L

DomainStartEndE-ValueType
low complexity region 56 84 N/A INTRINSIC
low complexity region 192 201 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 487 495 N/A INTRINSIC
low complexity region 500 515 N/A INTRINSIC
Pfam:Laminin_G_3 551 791 5.3e-6 PFAM
low complexity region 987 1001 N/A INTRINSIC
low complexity region 1101 1109 N/A INTRINSIC
low complexity region 1122 1136 N/A INTRINSIC
low complexity region 1332 1348 N/A INTRINSIC
low complexity region 1488 1503 N/A INTRINSIC
low complexity region 1594 1620 N/A INTRINSIC
low complexity region 1848 1877 N/A INTRINSIC
Pfam:PH_BEACH 1881 1975 3.1e-25 PFAM
Beach 2027 2307 3.8e-209 SMART
WD40 2405 2450 6.3e-2 SMART
WD40 2453 2492 3.8e-7 SMART
WD40 2504 2543 6.5e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a beige and Chediak-Higashi (BEACH) domain and multiple WD40 domains, and may play a role in megakaryocyte alpha-granule biogenesis. Mutations in this gene are a cause of gray platelet syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice exhibit megakaryocyte and platelet abnormalities resulting in impaired arterial thrombus formation and protection from infarction following cerebral ischemia. Wound repair is impaired. These abnormalities result in a bleeding disorder similiar to Gray Platelet Syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T C 10: 21,621,679 L73P probably damaging Het
4933412E24Rik T G 15: 60,015,675 R305S probably damaging Het
Adamts19 T A 18: 58,837,848 V168E probably damaging Het
Ankrd34b T A 13: 92,439,589 L443Q probably damaging Het
Ano3 A G 2: 110,661,271 Y887H probably damaging Het
Arhgef2 A T 3: 88,639,432 H553L probably benign Het
Atxn1 G T 13: 45,567,029 N463K probably benign Het
Birc6 A G 17: 74,625,104 probably null Het
C4bp A G 1: 130,636,745 S401P probably damaging Het
Cd5 T A 19: 10,720,245 R457W probably damaging Het
Chek2 T G 5: 110,848,436 Y127D probably damaging Het
Clec4a1 G A 6: 122,922,001 V10M probably damaging Het
Cltc A G 11: 86,712,631 Y790H probably damaging Het
Cops2 T C 2: 125,859,108 probably benign Het
Cyb5d2 A G 11: 72,789,103 F122S probably damaging Het
Daam1 T A 12: 71,951,915 L548H unknown Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dsg1a A C 18: 20,332,033 N427T probably benign Het
Ear14 A T 14: 51,204,107 D140V probably damaging Het
Epha4 A C 1: 77,506,910 F154C probably damaging Het
Ets2 G A 16: 95,706,454 V12M probably damaging Het
Fbxo40 G A 16: 36,969,308 T480I probably damaging Het
Fdps A T 3: 89,093,741 Y322N probably damaging Het
Gca T C 2: 62,686,356 M132T probably benign Het
Ifi203 T G 1: 173,937,930 K26T probably damaging Het
Itga10 A G 3: 96,654,800 R668G probably damaging Het
Itgal T C 7: 127,330,466 I1185T unknown Het
Kcnj13 A T 1: 87,386,467 N344K probably damaging Het
Kdm5a A T 6: 120,381,555 L186F probably benign Het
Klhl8 T C 5: 103,863,088 N624D probably benign Het
Klrb1 G T 6: 128,712,259 T83K possibly damaging Het
Krt77 TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 15: 101,859,972 probably benign Het
Ltb G T 17: 35,194,679 R53L probably benign Het
Mterf3 A G 13: 66,907,158 V69A Het
Mvb12a A G 8: 71,545,244 K101E probably damaging Het
Neb T A 2: 52,308,763 T389S possibly damaging Het
Nol4 A G 18: 23,040,012 F11L probably damaging Het
Olfr132 A G 17: 38,130,593 S200P probably damaging Het
Olfr441 A G 6: 43,116,506 I255V probably benign Het
Olfr675 C T 7: 105,024,678 G97R probably benign Het
Olfr9 T C 10: 128,990,839 L309P possibly damaging Het
Pde2a T A 7: 101,504,673 Y487N possibly damaging Het
Pde4a C T 9: 21,166,108 P61S possibly damaging Het
Pramef25 T A 4: 143,949,120 T379S probably benign Het
Prr5l A G 2: 101,741,285 probably null Het
Ptpn6 G A 6: 124,728,651 T179I possibly damaging Het
Ralyl T C 3: 14,039,776 S34P probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Robo2 A T 16: 74,015,926 C293* probably null Het
Rtn4 T G 11: 29,705,536 D169E probably damaging Het
Slc22a22 A T 15: 57,259,110 V157E probably damaging Het
Sytl2 A G 7: 90,385,075 T498A probably benign Het
Tgm6 G A 2: 130,137,438 V163I probably benign Het
Tnpo3 A T 6: 29,582,303 C187S possibly damaging Het
Ttn A G 2: 76,786,141 probably null Het
Vangl2 C A 1: 172,009,946 V99F possibly damaging Het
Vmn1r167 C T 7: 23,504,790 C267Y probably damaging Het
Vsig10l T C 7: 43,464,107 V161A possibly damaging Het
Xrcc5 G A 1: 72,325,085 R232Q possibly damaging Het
Xrcc6 C G 15: 82,029,262 F365L probably damaging Het
Zcchc11 G A 4: 108,479,708 A210T possibly damaging Het
Zdhhc13 A G 7: 48,815,509 Y389C probably damaging Het
Other mutations in Nbeal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Nbeal2 APN 9 110635869 missense probably damaging 1.00
IGL00784:Nbeal2 APN 9 110629763 splice site probably benign
IGL00826:Nbeal2 APN 9 110626903 missense probably benign
IGL00885:Nbeal2 APN 9 110638661 missense probably damaging 1.00
IGL01348:Nbeal2 APN 9 110629146 missense probably damaging 0.99
IGL01511:Nbeal2 APN 9 110629234 missense probably damaging 1.00
IGL01571:Nbeal2 APN 9 110632758 missense possibly damaging 0.63
IGL01612:Nbeal2 APN 9 110644678 missense probably damaging 1.00
IGL01924:Nbeal2 APN 9 110631414 missense probably benign 0.23
IGL02056:Nbeal2 APN 9 110627324 missense probably benign 0.17
IGL02481:Nbeal2 APN 9 110625995 nonsense probably null
IGL02483:Nbeal2 APN 9 110625995 nonsense probably null
IGL02502:Nbeal2 APN 9 110633768 missense probably damaging 1.00
IGL02631:Nbeal2 APN 9 110630208 missense probably damaging 0.99
IGL02637:Nbeal2 APN 9 110625977 missense possibly damaging 0.62
IGL02727:Nbeal2 APN 9 110639285 splice site probably benign
IGL02887:Nbeal2 APN 9 110628276 missense probably damaging 1.00
IGL02896:Nbeal2 APN 9 110639292 critical splice donor site probably null
IGL03110:Nbeal2 APN 9 110631433 missense probably damaging 1.00
Antonym UTSW 9 110630252 missense probably damaging 1.00
legion UTSW 9 110629179 missense probably damaging 1.00
litigious UTSW 9 110628195 missense probably damaging 1.00
mall UTSW 9 110632886 missense probably damaging 1.00
Mollusca UTSW 9 110645438 splice site probably null
Schleuter UTSW 9 110628744 missense possibly damaging 0.69
shellfish UTSW 9 110628720 missense probably damaging 1.00
F5770:Nbeal2 UTSW 9 110637937 missense possibly damaging 0.65
R0032:Nbeal2 UTSW 9 110637868 splice site probably benign
R0084:Nbeal2 UTSW 9 110643710 critical splice donor site probably null
R0147:Nbeal2 UTSW 9 110642143 nonsense probably null
R0294:Nbeal2 UTSW 9 110632859 missense probably damaging 1.00
R0310:Nbeal2 UTSW 9 110638163 missense probably damaging 1.00
R0494:Nbeal2 UTSW 9 110627187 missense probably damaging 1.00
R0550:Nbeal2 UTSW 9 110642158 missense probably benign 0.01
R0630:Nbeal2 UTSW 9 110636034 splice site probably benign
R0762:Nbeal2 UTSW 9 110643808 splice site probably benign
R0862:Nbeal2 UTSW 9 110628195 missense probably damaging 1.00
R0864:Nbeal2 UTSW 9 110628195 missense probably damaging 1.00
R1225:Nbeal2 UTSW 9 110632886 missense probably damaging 1.00
R1240:Nbeal2 UTSW 9 110627108 missense probably damaging 0.98
R1450:Nbeal2 UTSW 9 110633672 splice site probably benign
R1519:Nbeal2 UTSW 9 110636305 missense probably damaging 1.00
R1655:Nbeal2 UTSW 9 110632872 missense probably damaging 1.00
R1668:Nbeal2 UTSW 9 110638893 missense probably damaging 1.00
R1705:Nbeal2 UTSW 9 110625196 missense probably damaging 1.00
R1784:Nbeal2 UTSW 9 110630857 nonsense probably null
R1834:Nbeal2 UTSW 9 110627129 missense probably damaging 1.00
R1997:Nbeal2 UTSW 9 110632198 missense probably damaging 1.00
R2013:Nbeal2 UTSW 9 110634071 missense probably benign 0.09
R2014:Nbeal2 UTSW 9 110634071 missense probably benign 0.09
R2055:Nbeal2 UTSW 9 110635307 missense possibly damaging 0.92
R2086:Nbeal2 UTSW 9 110634071 missense probably benign 0.09
R2113:Nbeal2 UTSW 9 110625406 missense probably damaging 1.00
R2167:Nbeal2 UTSW 9 110638308 missense probably damaging 1.00
R2201:Nbeal2 UTSW 9 110630250 missense probably benign 0.16
R2309:Nbeal2 UTSW 9 110626570 missense probably damaging 1.00
R2378:Nbeal2 UTSW 9 110630808 missense probably damaging 0.99
R2945:Nbeal2 UTSW 9 110628068 missense possibly damaging 0.82
R3052:Nbeal2 UTSW 9 110633085 missense possibly damaging 0.93
R3076:Nbeal2 UTSW 9 110631700 missense probably damaging 1.00
R3176:Nbeal2 UTSW 9 110636887 splice site probably benign
R3974:Nbeal2 UTSW 9 110633846 missense probably damaging 1.00
R4183:Nbeal2 UTSW 9 110636675 missense probably benign
R4342:Nbeal2 UTSW 9 110631793 intron probably benign
R4654:Nbeal2 UTSW 9 110632004 missense probably damaging 1.00
R4707:Nbeal2 UTSW 9 110632055 missense probably benign 0.10
R4822:Nbeal2 UTSW 9 110636315 missense possibly damaging 0.82
R4854:Nbeal2 UTSW 9 110631396 missense probably damaging 1.00
R4860:Nbeal2 UTSW 9 110635194 missense probably benign 0.00
R4860:Nbeal2 UTSW 9 110635194 missense probably benign 0.00
R4990:Nbeal2 UTSW 9 110634803 missense probably benign 0.10
R4991:Nbeal2 UTSW 9 110638767 missense probably damaging 1.00
R5021:Nbeal2 UTSW 9 110637463 missense probably damaging 0.99
R5057:Nbeal2 UTSW 9 110631005 missense probably damaging 1.00
R5092:Nbeal2 UTSW 9 110626728 splice site probably null
R5161:Nbeal2 UTSW 9 110629868 missense probably benign
R5202:Nbeal2 UTSW 9 110644666 missense probably damaging 0.99
R5217:Nbeal2 UTSW 9 110632090 missense possibly damaging 0.56
R5408:Nbeal2 UTSW 9 110637520 missense possibly damaging 0.91
R5540:Nbeal2 UTSW 9 110631733 missense probably damaging 1.00
R5866:Nbeal2 UTSW 9 110631492 missense probably damaging 1.00
R5925:Nbeal2 UTSW 9 110629880 missense probably benign 0.00
R6057:Nbeal2 UTSW 9 110641877 missense possibly damaging 0.81
R6180:Nbeal2 UTSW 9 110625147 missense probably damaging 1.00
R6191:Nbeal2 UTSW 9 110627990 critical splice donor site probably null
R6232:Nbeal2 UTSW 9 110638734 missense probably damaging 1.00
R6372:Nbeal2 UTSW 9 110628744 missense possibly damaging 0.69
R6423:Nbeal2 UTSW 9 110625994 missense probably damaging 1.00
R6543:Nbeal2 UTSW 9 110644458 missense probably benign
R6648:Nbeal2 UTSW 9 110637642 missense probably damaging 1.00
R6722:Nbeal2 UTSW 9 110632992 missense probably damaging 1.00
R6738:Nbeal2 UTSW 9 110636905 missense possibly damaging 0.93
R6916:Nbeal2 UTSW 9 110626108 missense probably damaging 1.00
R6935:Nbeal2 UTSW 9 110639391 missense probably damaging 1.00
R7022:Nbeal2 UTSW 9 110638618 missense probably damaging 1.00
R7023:Nbeal2 UTSW 9 110638618 missense probably damaging 1.00
R7050:Nbeal2 UTSW 9 110628720 missense probably damaging 1.00
R7072:Nbeal2 UTSW 9 110626051 missense probably benign 0.01
R7073:Nbeal2 UTSW 9 110626109 missense probably damaging 0.99
R7099:Nbeal2 UTSW 9 110645438 splice site probably null
R7354:Nbeal2 UTSW 9 110629179 missense probably damaging 1.00
R7394:Nbeal2 UTSW 9 110630189 critical splice donor site probably null
R7397:Nbeal2 UTSW 9 110628032 missense possibly damaging 0.78
R7552:Nbeal2 UTSW 9 110653917 missense probably benign 0.16
R7619:Nbeal2 UTSW 9 110625818 missense probably benign 0.19
R7821:Nbeal2 UTSW 9 110630252 missense probably damaging 1.00
R7902:Nbeal2 UTSW 9 110637547 missense probably benign
R7923:Nbeal2 UTSW 9 110631446 nonsense probably null
R8018:Nbeal2 UTSW 9 110629157 unclassified probably benign
R8190:Nbeal2 UTSW 9 110626090 missense probably benign 0.04
R8404:Nbeal2 UTSW 9 110634389 missense possibly damaging 0.48
R8502:Nbeal2 UTSW 9 110634389 missense possibly damaging 0.48
V7583:Nbeal2 UTSW 9 110637937 missense possibly damaging 0.65
X0017:Nbeal2 UTSW 9 110644278 missense probably benign 0.02
X0065:Nbeal2 UTSW 9 110644413 splice site probably benign
Z1088:Nbeal2 UTSW 9 110632372 missense possibly damaging 0.51
Z1176:Nbeal2 UTSW 9 110625816 missense probably benign 0.01
Z1176:Nbeal2 UTSW 9 110638835 missense probably benign
Z1177:Nbeal2 UTSW 9 110629854 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCACTGGAGAACCCTGAAG -3'
(R):5'- TTGGGGACAGGATGACGTTC -3'

Sequencing Primer
(F):5'- AGCAGGGTTAGCAACAGCTCC -3'
(R):5'- ACAGGATGACGTTCTGCCC -3'
Posted On2020-07-28