Incidental Mutation 'R8297:Rtn4'
ID639027
Institutional Source Beutler Lab
Gene Symbol Rtn4
Ensembl Gene ENSMUSG00000020458
Gene Namereticulon 4
SynonymsNOGO, C130026I10Rik, NgA, 1110020G17Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.796) question?
Stock #R8297 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location29692947-29744331 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 29705536 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 169 (D169E)
Ref Sequence ENSEMBL: ENSMUSP00000099907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078830] [ENSMUST00000102841] [ENSMUST00000102842] [ENSMUST00000102843] [ENSMUST00000170731]
Predicted Effect probably benign
Transcript: ENSMUST00000078830
SMART Domains Protein: ENSMUSP00000077875
Gene: ENSMUSG00000020458

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
Pfam:Reticulon 169 339 4.2e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102841
AA Change: N53K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099905
Gene: ENSMUSG00000020458
AA Change: N53K

DomainStartEndE-ValueType
low complexity region 102 110 N/A INTRINSIC
Pfam:Reticulon 859 1029 6.3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102842
AA Change: D169E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000099906
Gene: ENSMUSG00000020458
AA Change: D169E

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
Pfam:Reticulon 188 358 4.8e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102843
AA Change: D169E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099907
Gene: ENSMUSG00000020458
AA Change: D169E

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
low complexity region 218 226 N/A INTRINSIC
Pfam:Reticulon 975 1139 2.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170731
SMART Domains Protein: ENSMUSP00000126413
Gene: ENSMUSG00000020458

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
Pfam:Reticulon 169 339 4.2e-58 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice lacking the A and B isoforms are viable and one line shows enhanced regeneration and recovery after spinal cord injury. Different lines of mice lacking isoforms A, B, and C show varying phenotypes. Whereas some produce viable homozygotes, others are embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T C 10: 21,621,679 L73P probably damaging Het
4933412E24Rik T G 15: 60,015,675 R305S probably damaging Het
Adamts19 T A 18: 58,837,848 V168E probably damaging Het
Ankrd34b T A 13: 92,439,589 L443Q probably damaging Het
Ano3 A G 2: 110,661,271 Y887H probably damaging Het
Arhgef2 A T 3: 88,639,432 H553L probably benign Het
Atxn1 G T 13: 45,567,029 N463K probably benign Het
Birc6 A G 17: 74,625,104 probably null Het
C4bp A G 1: 130,636,745 S401P probably damaging Het
Cd5 T A 19: 10,720,245 R457W probably damaging Het
Chek2 T G 5: 110,848,436 Y127D probably damaging Het
Clec4a1 G A 6: 122,922,001 V10M probably damaging Het
Cltc A G 11: 86,712,631 Y790H probably damaging Het
Cops2 T C 2: 125,859,108 probably benign Het
Cyb5d2 A G 11: 72,789,103 F122S probably damaging Het
Daam1 T A 12: 71,951,915 L548H unknown Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dsg1a A C 18: 20,332,033 N427T probably benign Het
Ear14 A T 14: 51,204,107 D140V probably damaging Het
Epha4 A C 1: 77,506,910 F154C probably damaging Het
Ets2 G A 16: 95,706,454 V12M probably damaging Het
Fbxo40 G A 16: 36,969,308 T480I probably damaging Het
Fdps A T 3: 89,093,741 Y322N probably damaging Het
Gca T C 2: 62,686,356 M132T probably benign Het
Ifi203 T G 1: 173,937,930 K26T probably damaging Het
Itga10 A G 3: 96,654,800 R668G probably damaging Het
Itgal T C 7: 127,330,466 I1185T unknown Het
Kcnj13 A T 1: 87,386,467 N344K probably damaging Het
Kdm5a A T 6: 120,381,555 L186F probably benign Het
Klhl8 T C 5: 103,863,088 N624D probably benign Het
Klrb1 G T 6: 128,712,259 T83K possibly damaging Het
Krt77 TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 15: 101,859,972 probably benign Het
Ltb G T 17: 35,194,679 R53L probably benign Het
Mterf3 A G 13: 66,907,158 V69A Het
Mvb12a A G 8: 71,545,244 K101E probably damaging Het
Nbeal2 T A 9: 110,635,341 Q1110L possibly damaging Het
Neb T A 2: 52,308,763 T389S possibly damaging Het
Nol4 A G 18: 23,040,012 F11L probably damaging Het
Olfr132 A G 17: 38,130,593 S200P probably damaging Het
Olfr441 A G 6: 43,116,506 I255V probably benign Het
Olfr675 C T 7: 105,024,678 G97R probably benign Het
Olfr9 T C 10: 128,990,839 L309P possibly damaging Het
Pde2a T A 7: 101,504,673 Y487N possibly damaging Het
Pde4a C T 9: 21,166,108 P61S possibly damaging Het
Pramef25 T A 4: 143,949,120 T379S probably benign Het
Prr5l A G 2: 101,741,285 probably null Het
Ptpn6 G A 6: 124,728,651 T179I possibly damaging Het
Ralyl T C 3: 14,039,776 S34P probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Robo2 A T 16: 74,015,926 C293* probably null Het
Slc22a22 A T 15: 57,259,110 V157E probably damaging Het
Sytl2 A G 7: 90,385,075 T498A probably benign Het
Tgm6 G A 2: 130,137,438 V163I probably benign Het
Tnpo3 A T 6: 29,582,303 C187S possibly damaging Het
Ttn A G 2: 76,786,141 probably null Het
Vangl2 C A 1: 172,009,946 V99F possibly damaging Het
Vmn1r167 C T 7: 23,504,790 C267Y probably damaging Het
Vsig10l T C 7: 43,464,107 V161A possibly damaging Het
Xrcc5 G A 1: 72,325,085 R232Q possibly damaging Het
Xrcc6 C G 15: 82,029,262 F365L probably damaging Het
Zcchc11 G A 4: 108,479,708 A210T possibly damaging Het
Zdhhc13 A G 7: 48,815,509 Y389C probably damaging Het
Other mutations in Rtn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Rtn4 APN 11 29707291 missense probably damaging 1.00
IGL02187:Rtn4 APN 11 29708291 missense possibly damaging 0.78
IGL02475:Rtn4 APN 11 29733801 missense probably damaging 1.00
IGL02751:Rtn4 APN 11 29706409 critical splice acceptor site probably null
R0063:Rtn4 UTSW 11 29705527 intron probably benign
R0110:Rtn4 UTSW 11 29733849 splice site probably benign
R0510:Rtn4 UTSW 11 29733849 splice site probably benign
R0653:Rtn4 UTSW 11 29707256 missense probably damaging 1.00
R0658:Rtn4 UTSW 11 29706475 missense probably damaging 1.00
R1353:Rtn4 UTSW 11 29707595 missense probably damaging 1.00
R1384:Rtn4 UTSW 11 29736437 missense probably damaging 1.00
R1406:Rtn4 UTSW 11 29708236 missense probably benign 0.21
R1406:Rtn4 UTSW 11 29708236 missense probably benign 0.21
R1873:Rtn4 UTSW 11 29736437 missense probably damaging 1.00
R1960:Rtn4 UTSW 11 29736464 missense probably damaging 1.00
R1980:Rtn4 UTSW 11 29708634 missense probably benign 0.00
R2319:Rtn4 UTSW 11 29707154 missense probably benign 0.06
R2888:Rtn4 UTSW 11 29693687 missense probably damaging 0.98
R3150:Rtn4 UTSW 11 29693308 small deletion probably benign
R3403:Rtn4 UTSW 11 29707690 missense probably benign 0.12
R3974:Rtn4 UTSW 11 29707505 missense probably damaging 1.00
R3977:Rtn4 UTSW 11 29693819 missense probably benign 0.01
R4223:Rtn4 UTSW 11 29706856 missense probably benign 0.02
R4725:Rtn4 UTSW 11 29708362 missense probably damaging 1.00
R4801:Rtn4 UTSW 11 29708660 missense probably benign 0.21
R4802:Rtn4 UTSW 11 29708660 missense probably benign 0.21
R4974:Rtn4 UTSW 11 29740994 missense probably damaging 1.00
R4983:Rtn4 UTSW 11 29707217 missense probably benign 0.43
R5292:Rtn4 UTSW 11 29707924 missense probably benign 0.39
R5332:Rtn4 UTSW 11 29733645 missense probably damaging 1.00
R5551:Rtn4 UTSW 11 29741011 missense probably damaging 1.00
R5604:Rtn4 UTSW 11 29708140 missense probably damaging 0.97
R6046:Rtn4 UTSW 11 29708023 missense probably damaging 1.00
R6928:Rtn4 UTSW 11 29706791 missense possibly damaging 0.92
R7386:Rtn4 UTSW 11 29707772 missense probably damaging 1.00
R7743:Rtn4 UTSW 11 29733790 nonsense probably null
R7784:Rtn4 UTSW 11 29741048 nonsense probably null
R7832:Rtn4 UTSW 11 29741048 nonsense probably null
R7846:Rtn4 UTSW 11 29693274 missense unknown
R7896:Rtn4 UTSW 11 29705536 missense probably damaging 1.00
R8420:Rtn4 UTSW 11 29707300 missense probably damaging 0.99
RF006:Rtn4 UTSW 11 29706919 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGCTGTATTGCCTCTCAAACAATG -3'
(R):5'- CCAAGAGTCCAAGAATTCCTTATG -3'

Sequencing Primer
(F):5'- GTATTGCCTCTCAAACAATGACTAAC -3'
(R):5'- TGAATCAAATCCTGACCATGTCTC -3'
Posted On2020-07-28