Incidental Mutation 'R0697:Sirt5'
ID 63903
Institutional Source Beutler Lab
Gene Symbol Sirt5
Ensembl Gene ENSMUSG00000054021
Gene Name sirtuin 5
Synonyms 1500032M05Rik, 0610012J09Rik
MMRRC Submission 038881-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0697 (G1)
Quality Score 130
Status Not validated
Chromosome 13
Chromosomal Location 43365496-43395203 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43385576 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 274 (F274L)
Ref Sequence ENSEMBL: ENSMUSP00000152526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066804] [ENSMUST00000220576] [ENSMUST00000221481] [ENSMUST00000221515] [ENSMUST00000223194]
AlphaFold Q8K2C6
Predicted Effect probably damaging
Transcript: ENSMUST00000066804
AA Change: F274L

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071048
Gene: ENSMUSG00000054021
AA Change: F274L

DomainStartEndE-ValueType
Pfam:SIR2 58 256 5.3e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000220576
AA Change: F274L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220874
Predicted Effect probably damaging
Transcript: ENSMUST00000221481
AA Change: F274L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000221515
AA Change: F274L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221955
Predicted Effect unknown
Transcript: ENSMUST00000222106
AA Change: F115L
Predicted Effect probably damaging
Transcript: ENSMUST00000223194
AA Change: F274L

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class III of the sirtuin family. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly healthy and do not exhibit globally increased mitochondrial protein acetylation levels relative to wild-type controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C A 19: 31,911,167 A99E probably damaging Het
Aig1 T C 10: 13,829,325 N72S probably benign Het
Atad2 T C 15: 58,105,543 I857M possibly damaging Het
Ceacam15 A C 7: 16,673,520 L24* probably null Het
Cpsf2 A G 12: 101,983,184 H53R probably benign Het
Crh C A 3: 19,694,077 G134C probably damaging Het
Cyp2g1 A T 7: 26,814,727 K253* probably null Het
Dna2 T C 10: 62,949,341 V79A probably benign Het
Dsc2 A G 18: 20,041,452 V549A probably damaging Het
Etl4 G T 2: 20,743,861 V135F probably damaging Het
Frk A G 10: 34,607,837 H398R probably benign Het
Gfra1 A C 19: 58,270,123 S271A probably benign Het
Htr1b T C 9: 81,631,463 I364V possibly damaging Het
Kcnh5 A T 12: 74,976,531 C588S possibly damaging Het
Kif13a G A 13: 46,848,337 T70I probably benign Het
Klra6 T C 6: 130,016,724 I195V probably benign Het
Nras T C 3: 103,060,300 Y71H possibly damaging Het
Synj1 T C 16: 90,960,615 T882A probably benign Het
Vmn1r84 A T 7: 12,362,763 M1K probably null Het
Zfhx4 A T 3: 5,401,733 E2317V probably damaging Het
Zfp345 A T 2: 150,472,909 I236K probably benign Het
Other mutations in Sirt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02321:Sirt5 APN 13 43379688 missense probably damaging 1.00
R0584:Sirt5 UTSW 13 43394728 splice site probably null
R1022:Sirt5 UTSW 13 43370769 missense probably benign 0.05
R1024:Sirt5 UTSW 13 43370769 missense probably benign 0.05
R1352:Sirt5 UTSW 13 43394807 missense probably damaging 1.00
R1874:Sirt5 UTSW 13 43370791 missense possibly damaging 0.92
R3552:Sirt5 UTSW 13 43383167 missense probably damaging 1.00
R3778:Sirt5 UTSW 13 43383107 critical splice acceptor site probably null
R5591:Sirt5 UTSW 13 43371841 missense possibly damaging 0.67
R7188:Sirt5 UTSW 13 43371904 missense possibly damaging 0.93
R7788:Sirt5 UTSW 13 43383147 missense probably benign 0.43
R8063:Sirt5 UTSW 13 43370847 missense probably benign 0.00
R8347:Sirt5 UTSW 13 43380501 missense probably benign 0.00
R8859:Sirt5 UTSW 13 43370851 missense possibly damaging 0.75
R9339:Sirt5 UTSW 13 43376851 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCTGCCTGAGCAAGTTTCTCTGTTG -3'
(R):5'- ACACCCAGTCTGCTGTTAATGCC -3'

Sequencing Primer
(F):5'- GAGCAAGTTTCTCTGTTGTTTCC -3'
(R):5'- tgggaggcagaggcagg -3'
Posted On 2013-07-30