Incidental Mutation 'R8297:Dcp1a'
ID639034
Institutional Source Beutler Lab
Gene Symbol Dcp1a
Ensembl Gene ENSMUSG00000021962
Gene Namedecapping mRNA 1A
Synonyms1110066A22Rik, Mitc1, 4930568L04Rik, SMIF, D14Ertd817e
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R8297 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location30479535-30527063 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30522926 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 570 (T570A)
Ref Sequence ENSEMBL: ENSMUSP00000022535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022535] [ENSMUST00000225196] [ENSMUST00000225286]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022535
AA Change: T570A

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022535
Gene: ENSMUSG00000021962
AA Change: T570A

DomainStartEndE-ValueType
Pfam:DCP1 28 144 1.8e-44 PFAM
low complexity region 327 343 N/A INTRINSIC
low complexity region 457 472 N/A INTRINSIC
Pfam:mRNA_decap_C 559 601 6.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223658
Predicted Effect possibly damaging
Transcript: ENSMUST00000225196
AA Change: T570A

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000225286
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Decapping is a key step in general and regulated mRNA decay. The protein encoded by this gene is a decapping enzyme. This protein and another decapping enzyme form a decapping complex, which interacts with the nonsense-mediated decay factor hUpf1 and may be recruited to mRNAs containing premature termination codons. This protein also participates in the TGF-beta signaling pathway. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T C 10: 21,621,679 L73P probably damaging Het
4933412E24Rik T G 15: 60,015,675 R305S probably damaging Het
Adamts19 T A 18: 58,837,848 V168E probably damaging Het
Ankrd34b T A 13: 92,439,589 L443Q probably damaging Het
Ano3 A G 2: 110,661,271 Y887H probably damaging Het
Arhgef2 A T 3: 88,639,432 H553L probably benign Het
Atxn1 G T 13: 45,567,029 N463K probably benign Het
Birc6 A G 17: 74,625,104 probably null Het
C4bp A G 1: 130,636,745 S401P probably damaging Het
Cd5 T A 19: 10,720,245 R457W probably damaging Het
Chek2 T G 5: 110,848,436 Y127D probably damaging Het
Clec4a1 G A 6: 122,922,001 V10M probably damaging Het
Cltc A G 11: 86,712,631 Y790H probably damaging Het
Cops2 T C 2: 125,859,108 probably benign Het
Cyb5d2 A G 11: 72,789,103 F122S probably damaging Het
Daam1 T A 12: 71,951,915 L548H unknown Het
Dsg1a A C 18: 20,332,033 N427T probably benign Het
Ear14 A T 14: 51,204,107 D140V probably damaging Het
Epha4 A C 1: 77,506,910 F154C probably damaging Het
Ets2 G A 16: 95,706,454 V12M probably damaging Het
Fbxo40 G A 16: 36,969,308 T480I probably damaging Het
Fdps A T 3: 89,093,741 Y322N probably damaging Het
Gca T C 2: 62,686,356 M132T probably benign Het
Ifi203 T G 1: 173,937,930 K26T probably damaging Het
Itga10 A G 3: 96,654,800 R668G probably damaging Het
Itgal T C 7: 127,330,466 I1185T unknown Het
Kcnj13 A T 1: 87,386,467 N344K probably damaging Het
Kdm5a A T 6: 120,381,555 L186F probably benign Het
Klhl8 T C 5: 103,863,088 N624D probably benign Het
Klrb1 G T 6: 128,712,259 T83K possibly damaging Het
Krt77 TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 15: 101,859,972 probably benign Het
Ltb G T 17: 35,194,679 R53L probably benign Het
Mterf3 A G 13: 66,907,158 V69A Het
Mvb12a A G 8: 71,545,244 K101E probably damaging Het
Nbeal2 T A 9: 110,635,341 Q1110L possibly damaging Het
Neb T A 2: 52,308,763 T389S possibly damaging Het
Nol4 A G 18: 23,040,012 F11L probably damaging Het
Olfr132 A G 17: 38,130,593 S200P probably damaging Het
Olfr441 A G 6: 43,116,506 I255V probably benign Het
Olfr675 C T 7: 105,024,678 G97R probably benign Het
Olfr9 T C 10: 128,990,839 L309P possibly damaging Het
Pde2a T A 7: 101,504,673 Y487N possibly damaging Het
Pde4a C T 9: 21,166,108 P61S possibly damaging Het
Pramef25 T A 4: 143,949,120 T379S probably benign Het
Prr5l A G 2: 101,741,285 probably null Het
Ptpn6 G A 6: 124,728,651 T179I possibly damaging Het
Ralyl T C 3: 14,039,776 S34P probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Robo2 A T 16: 74,015,926 C293* probably null Het
Rtn4 T G 11: 29,705,536 D169E probably damaging Het
Slc22a22 A T 15: 57,259,110 V157E probably damaging Het
Sytl2 A G 7: 90,385,075 T498A probably benign Het
Tgm6 G A 2: 130,137,438 V163I probably benign Het
Tnpo3 A T 6: 29,582,303 C187S possibly damaging Het
Ttn A G 2: 76,786,141 probably null Het
Vangl2 C A 1: 172,009,946 V99F possibly damaging Het
Vmn1r167 C T 7: 23,504,790 C267Y probably damaging Het
Vsig10l T C 7: 43,464,107 V161A possibly damaging Het
Xrcc5 G A 1: 72,325,085 R232Q possibly damaging Het
Xrcc6 C G 15: 82,029,262 F365L probably damaging Het
Zcchc11 G A 4: 108,479,708 A210T possibly damaging Het
Zdhhc13 A G 7: 48,815,509 Y389C probably damaging Het
Other mutations in Dcp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Dcp1a APN 14 30505571 missense possibly damaging 0.52
IGL02698:Dcp1a APN 14 30505542 splice site probably benign
IGL02799:Dcp1a UTSW 14 30519679 critical splice donor site probably null
R0240:Dcp1a UTSW 14 30484594 splice site probably benign
R0387:Dcp1a UTSW 14 30519679 critical splice donor site probably null
R0646:Dcp1a UTSW 14 30502885 missense probably damaging 1.00
R1781:Dcp1a UTSW 14 30513075 missense probably benign 0.37
R1843:Dcp1a UTSW 14 30518983 missense probably damaging 0.99
R2111:Dcp1a UTSW 14 30519370 missense probably benign 0.00
R3176:Dcp1a UTSW 14 30505542 splice site probably benign
R4948:Dcp1a UTSW 14 30479767 missense probably damaging 1.00
R5541:Dcp1a UTSW 14 30502839 missense probably damaging 1.00
R6178:Dcp1a UTSW 14 30523304 makesense probably null
R7767:Dcp1a UTSW 14 30479818 critical splice donor site probably null
R7818:Dcp1a UTSW 14 30479721 missense probably damaging 0.99
R8248:Dcp1a UTSW 14 30479598 intron probably benign
R8248:Dcp1a UTSW 14 30522926 missense possibly damaging 0.87
R8250:Dcp1a UTSW 14 30522926 missense possibly damaging 0.87
R8271:Dcp1a UTSW 14 30522926 missense possibly damaging 0.87
R8302:Dcp1a UTSW 14 30522926 missense possibly damaging 0.87
R8326:Dcp1a UTSW 14 30519570 nonsense probably null
R8333:Dcp1a UTSW 14 30522926 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TTCTGTGTCCCGGCAGATTG -3'
(R):5'- CCCAGAGGCAGTTACAATGACAG -3'

Sequencing Primer
(F):5'- CAGATTGCAGGCTCTCCATTGG -3'
(R):5'- TGACAGTCCAGGTTTACAGC -3'
Posted On2020-07-28