Incidental Mutation 'R8297:Xrcc6'
ID639038
Institutional Source Beutler Lab
Gene Symbol Xrcc6
Ensembl Gene ENSMUSG00000022471
Gene NameX-ray repair complementing defective repair in Chinese hamster cells 6
SynonymsKu p70, G22p1, Ku70
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8297 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location81987835-82040085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 82029262 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 365 (F365L)
Ref Sequence ENSEMBL: ENSMUSP00000068559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069530] [ENSMUST00000100399] [ENSMUST00000164779] [ENSMUST00000170630]
Predicted Effect probably damaging
Transcript: ENSMUST00000069530
AA Change: F365L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068559
Gene: ENSMUSG00000022471
AA Change: F365L

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
VWA 32 246 1.79e0 SMART
Ku78 306 452 2.91e-56 SMART
Pfam:Ku_C 467 557 5e-34 PFAM
SAP 571 605 2.38e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100399
AA Change: F365L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097968
Gene: ENSMUSG00000022471
AA Change: F365L

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
VWA 32 246 1.79e0 SMART
Ku78 306 452 2.91e-56 SMART
Pfam:Ku_C 470 555 3.1e-31 PFAM
SAP 571 605 2.38e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164779
SMART Domains Protein: ENSMUSP00000127927
Gene: ENSMUSG00000022471

DomainStartEndE-ValueType
Pfam:Ku_N 1 96 4.6e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170630
SMART Domains Protein: ENSMUSP00000126245
Gene: ENSMUSG00000022471

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:Ku_N 35 205 1.2e-59 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The p70/p80 autoantigen is a nuclear complex consisting of two subunits with molecular masses of approximately 70 and 80 kDa. The complex functions as a single-stranded DNA-dependent ATP-dependent helicase. The complex may be involved in the repair of nonhomologous DNA ends such as that required for double-strand break repair, transposition, and V(D)J recombination. High levels of autoantibodies to p70 and p80 have been found in some patients with systemic lupus erythematosus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neuron apoptosis, decreased body size, abnormal B and T cell morphology, increased incidence of tumorigenesis, and increased cellular sensitivity to irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T C 10: 21,621,679 L73P probably damaging Het
4933412E24Rik T G 15: 60,015,675 R305S probably damaging Het
Adamts19 T A 18: 58,837,848 V168E probably damaging Het
Ankrd34b T A 13: 92,439,589 L443Q probably damaging Het
Ano3 A G 2: 110,661,271 Y887H probably damaging Het
Arhgef2 A T 3: 88,639,432 H553L probably benign Het
Atxn1 G T 13: 45,567,029 N463K probably benign Het
Birc6 A G 17: 74,625,104 probably null Het
C4bp A G 1: 130,636,745 S401P probably damaging Het
Cd5 T A 19: 10,720,245 R457W probably damaging Het
Chek2 T G 5: 110,848,436 Y127D probably damaging Het
Clec4a1 G A 6: 122,922,001 V10M probably damaging Het
Cltc A G 11: 86,712,631 Y790H probably damaging Het
Cops2 T C 2: 125,859,108 probably benign Het
Cyb5d2 A G 11: 72,789,103 F122S probably damaging Het
Daam1 T A 12: 71,951,915 L548H unknown Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dsg1a A C 18: 20,332,033 N427T probably benign Het
Ear14 A T 14: 51,204,107 D140V probably damaging Het
Epha4 A C 1: 77,506,910 F154C probably damaging Het
Ets2 G A 16: 95,706,454 V12M probably damaging Het
Fbxo40 G A 16: 36,969,308 T480I probably damaging Het
Fdps A T 3: 89,093,741 Y322N probably damaging Het
Gca T C 2: 62,686,356 M132T probably benign Het
Ifi203 T G 1: 173,937,930 K26T probably damaging Het
Itga10 A G 3: 96,654,800 R668G probably damaging Het
Itgal T C 7: 127,330,466 I1185T unknown Het
Kcnj13 A T 1: 87,386,467 N344K probably damaging Het
Kdm5a A T 6: 120,381,555 L186F probably benign Het
Klhl8 T C 5: 103,863,088 N624D probably benign Het
Klrb1 G T 6: 128,712,259 T83K possibly damaging Het
Krt77 TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 15: 101,859,972 probably benign Het
Ltb G T 17: 35,194,679 R53L probably benign Het
Mterf3 A G 13: 66,907,158 V69A Het
Mvb12a A G 8: 71,545,244 K101E probably damaging Het
Nbeal2 T A 9: 110,635,341 Q1110L possibly damaging Het
Neb T A 2: 52,308,763 T389S possibly damaging Het
Nol4 A G 18: 23,040,012 F11L probably damaging Het
Olfr132 A G 17: 38,130,593 S200P probably damaging Het
Olfr441 A G 6: 43,116,506 I255V probably benign Het
Olfr675 C T 7: 105,024,678 G97R probably benign Het
Olfr9 T C 10: 128,990,839 L309P possibly damaging Het
Pde2a T A 7: 101,504,673 Y487N possibly damaging Het
Pde4a C T 9: 21,166,108 P61S possibly damaging Het
Pramef25 T A 4: 143,949,120 T379S probably benign Het
Prr5l A G 2: 101,741,285 probably null Het
Ptpn6 G A 6: 124,728,651 T179I possibly damaging Het
Ralyl T C 3: 14,039,776 S34P probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Robo2 A T 16: 74,015,926 C293* probably null Het
Rtn4 T G 11: 29,705,536 D169E probably damaging Het
Slc22a22 A T 15: 57,259,110 V157E probably damaging Het
Sytl2 A G 7: 90,385,075 T498A probably benign Het
Tgm6 G A 2: 130,137,438 V163I probably benign Het
Tnpo3 A T 6: 29,582,303 C187S possibly damaging Het
Ttn A G 2: 76,786,141 probably null Het
Vangl2 C A 1: 172,009,946 V99F possibly damaging Het
Vmn1r167 C T 7: 23,504,790 C267Y probably damaging Het
Vsig10l T C 7: 43,464,107 V161A possibly damaging Het
Xrcc5 G A 1: 72,325,085 R232Q possibly damaging Het
Zcchc11 G A 4: 108,479,708 A210T possibly damaging Het
Zdhhc13 A G 7: 48,815,509 Y389C probably damaging Het
Other mutations in Xrcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00701:Xrcc6 APN 15 82017200 critical splice donor site probably null
IGL01394:Xrcc6 APN 15 82025661 missense possibly damaging 0.69
IGL01648:Xrcc6 APN 15 82025634 missense probably damaging 0.96
R0312:Xrcc6 UTSW 15 82027222 splice site probably null
R0522:Xrcc6 UTSW 15 82022592 splice site probably benign
R1172:Xrcc6 UTSW 15 82031163 missense probably damaging 1.00
R1173:Xrcc6 UTSW 15 82031163 missense probably damaging 1.00
R1218:Xrcc6 UTSW 15 82022941 missense probably benign 0.00
R1269:Xrcc6 UTSW 15 82022847 missense possibly damaging 0.49
R1677:Xrcc6 UTSW 15 82029699 missense probably benign
R2049:Xrcc6 UTSW 15 82022977 missense probably damaging 1.00
R2140:Xrcc6 UTSW 15 82022977 missense probably damaging 1.00
R2142:Xrcc6 UTSW 15 82022977 missense probably damaging 1.00
R3737:Xrcc6 UTSW 15 82029631 missense probably damaging 1.00
R3870:Xrcc6 UTSW 15 82025684 missense probably benign 0.16
R3906:Xrcc6 UTSW 15 82029571 missense probably benign 0.01
R4197:Xrcc6 UTSW 15 82029224 missense probably benign 0.06
R4589:Xrcc6 UTSW 15 82022460 missense probably damaging 1.00
R4941:Xrcc6 UTSW 15 82039812 missense probably damaging 1.00
R5318:Xrcc6 UTSW 15 82037507 missense probably damaging 1.00
R5356:Xrcc6 UTSW 15 82029218 missense probably benign 0.00
R5576:Xrcc6 UTSW 15 82022492 missense probably damaging 1.00
R6157:Xrcc6 UTSW 15 82029104 splice site probably null
R6596:Xrcc6 UTSW 15 82022954 start codon destroyed probably null 0.58
R6904:Xrcc6 UTSW 15 82029122 missense probably benign 0.19
R6970:Xrcc6 UTSW 15 82031174 missense probably benign 0.03
R7098:Xrcc6 UTSW 15 82035754 nonsense probably null
R7213:Xrcc6 UTSW 15 82016826 intron probably benign
R7642:Xrcc6 UTSW 15 82016477 critical splice donor site probably null
R7845:Xrcc6 UTSW 15 82016477 critical splice donor site probably null
R8105:Xrcc6 UTSW 15 82031151 missense probably damaging 1.00
X0063:Xrcc6 UTSW 15 82022493 missense possibly damaging 0.92
Z1176:Xrcc6 UTSW 15 82029213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGTGGCCGCAGATTCATC -3'
(R):5'- GCATCTCTTGTAGGTATCTCAGCC -3'

Sequencing Primer
(F):5'- GGCCGCAGATTCATCTCCAC -3'
(R):5'- GGTATCTCAGCCATTTAGGAAACAC -3'
Posted On2020-07-28