Incidental Mutation 'R8297:Krt77'
ID639039
Institutional Source Beutler Lab
Gene Symbol Krt77
Ensembl Gene ENSMUSG00000067594
Gene Namekeratin 77
Synonyms4732484G22Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8297 (G1)
Quality Score111.467
Status Not validated
Chromosome15
Chromosomal Location101858731-101869705 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) TGCCGCCGCCGCCGCCGCCGCCGCCGC to TGCCGCCGCCGCCGCCGCCGCCGC at 101859972 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000085311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087996]
Predicted Effect probably benign
Transcript: ENSMUST00000087996
SMART Domains Protein: ENSMUSP00000085311
Gene: ENSMUSG00000067594

DomainStartEndE-ValueType
Pfam:Keratin_2_head 4 163 1.5e-46 PFAM
Filament 166 479 6.11e-149 SMART
low complexity region 485 497 N/A INTRINSIC
low complexity region 500 543 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes an epithelial keratin that is expressed in the skin and eccrine sweat glands. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T C 10: 21,621,679 L73P probably damaging Het
4933412E24Rik T G 15: 60,015,675 R305S probably damaging Het
Adamts19 T A 18: 58,837,848 V168E probably damaging Het
Ankrd34b T A 13: 92,439,589 L443Q probably damaging Het
Ano3 A G 2: 110,661,271 Y887H probably damaging Het
Arhgef2 A T 3: 88,639,432 H553L probably benign Het
Atxn1 G T 13: 45,567,029 N463K probably benign Het
Birc6 A G 17: 74,625,104 probably null Het
C4bp A G 1: 130,636,745 S401P probably damaging Het
Cd5 T A 19: 10,720,245 R457W probably damaging Het
Chek2 T G 5: 110,848,436 Y127D probably damaging Het
Clec4a1 G A 6: 122,922,001 V10M probably damaging Het
Cltc A G 11: 86,712,631 Y790H probably damaging Het
Cops2 T C 2: 125,859,108 probably benign Het
Cyb5d2 A G 11: 72,789,103 F122S probably damaging Het
Daam1 T A 12: 71,951,915 L548H unknown Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dsg1a A C 18: 20,332,033 N427T probably benign Het
Ear14 A T 14: 51,204,107 D140V probably damaging Het
Epha4 A C 1: 77,506,910 F154C probably damaging Het
Ets2 G A 16: 95,706,454 V12M probably damaging Het
Fbxo40 G A 16: 36,969,308 T480I probably damaging Het
Fdps A T 3: 89,093,741 Y322N probably damaging Het
Gca T C 2: 62,686,356 M132T probably benign Het
Ifi203 T G 1: 173,937,930 K26T probably damaging Het
Itga10 A G 3: 96,654,800 R668G probably damaging Het
Itgal T C 7: 127,330,466 I1185T unknown Het
Kcnj13 A T 1: 87,386,467 N344K probably damaging Het
Kdm5a A T 6: 120,381,555 L186F probably benign Het
Klhl8 T C 5: 103,863,088 N624D probably benign Het
Klrb1 G T 6: 128,712,259 T83K possibly damaging Het
Ltb G T 17: 35,194,679 R53L probably benign Het
Mterf3 A G 13: 66,907,158 V69A Het
Mvb12a A G 8: 71,545,244 K101E probably damaging Het
Nbeal2 T A 9: 110,635,341 Q1110L possibly damaging Het
Neb T A 2: 52,308,763 T389S possibly damaging Het
Nol4 A G 18: 23,040,012 F11L probably damaging Het
Olfr132 A G 17: 38,130,593 S200P probably damaging Het
Olfr441 A G 6: 43,116,506 I255V probably benign Het
Olfr675 C T 7: 105,024,678 G97R probably benign Het
Olfr9 T C 10: 128,990,839 L309P possibly damaging Het
Pde2a T A 7: 101,504,673 Y487N possibly damaging Het
Pde4a C T 9: 21,166,108 P61S possibly damaging Het
Pramef25 T A 4: 143,949,120 T379S probably benign Het
Prr5l A G 2: 101,741,285 probably null Het
Ptpn6 G A 6: 124,728,651 T179I possibly damaging Het
Ralyl T C 3: 14,039,776 S34P probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Robo2 A T 16: 74,015,926 C293* probably null Het
Rtn4 T G 11: 29,705,536 D169E probably damaging Het
Slc22a22 A T 15: 57,259,110 V157E probably damaging Het
Sytl2 A G 7: 90,385,075 T498A probably benign Het
Tgm6 G A 2: 130,137,438 V163I probably benign Het
Tnpo3 A T 6: 29,582,303 C187S possibly damaging Het
Ttn A G 2: 76,786,141 probably null Het
Vangl2 C A 1: 172,009,946 V99F possibly damaging Het
Vmn1r167 C T 7: 23,504,790 C267Y probably damaging Het
Vsig10l T C 7: 43,464,107 V161A possibly damaging Het
Xrcc5 G A 1: 72,325,085 R232Q possibly damaging Het
Xrcc6 C G 15: 82,029,262 F365L probably damaging Het
Zcchc11 G A 4: 108,479,708 A210T possibly damaging Het
Zdhhc13 A G 7: 48,815,509 Y389C probably damaging Het
Other mutations in Krt77
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Krt77 APN 15 101860880 splice site probably benign
IGL01912:Krt77 APN 15 101863851 splice site probably benign
IGL02505:Krt77 APN 15 101860946 missense probably damaging 1.00
IGL02875:Krt77 APN 15 101869149 missense probably damaging 1.00
R0266:Krt77 UTSW 15 101869378 missense possibly damaging 0.71
R0347:Krt77 UTSW 15 101859869 missense unknown
R0762:Krt77 UTSW 15 101861126 splice site probably null
R1528:Krt77 UTSW 15 101861088 missense probably damaging 1.00
R1556:Krt77 UTSW 15 101861278 missense probably damaging 0.96
R1973:Krt77 UTSW 15 101861244 missense probably damaging 1.00
R4434:Krt77 UTSW 15 101865469 missense probably damaging 1.00
R4436:Krt77 UTSW 15 101865469 missense probably damaging 1.00
R4946:Krt77 UTSW 15 101869563 missense unknown
R5405:Krt77 UTSW 15 101861088 missense probably damaging 0.96
R5507:Krt77 UTSW 15 101861230 missense probably benign 0.03
R5888:Krt77 UTSW 15 101865453 missense probably benign 0.29
R5978:Krt77 UTSW 15 101862928 missense probably benign 0.07
R5994:Krt77 UTSW 15 101862855 missense probably damaging 1.00
R6039:Krt77 UTSW 15 101860916 missense possibly damaging 0.85
R6039:Krt77 UTSW 15 101860916 missense possibly damaging 0.85
R6241:Krt77 UTSW 15 101865553 missense probably damaging 1.00
R6260:Krt77 UTSW 15 101864372 nonsense probably null
R6280:Krt77 UTSW 15 101865475 missense probably damaging 1.00
R6500:Krt77 UTSW 15 101864337 missense probably damaging 0.99
R6563:Krt77 UTSW 15 101862923 missense probably damaging 1.00
R7153:Krt77 UTSW 15 101865496 missense probably benign 0.18
R7156:Krt77 UTSW 15 101865496 missense probably benign 0.18
R7205:Krt77 UTSW 15 101869371 missense probably benign 0.00
R7379:Krt77 UTSW 15 101861274 missense probably damaging 1.00
R7407:Krt77 UTSW 15 101860095 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTCTGAGTGTCGTCACCTG -3'
(R):5'- GAGTTCTCCTGGCCATTCTG -3'

Sequencing Primer
(F):5'- AACTTGCTGAGACCCATTGG -3'
(R):5'- AGTTCTCCTGGCCATTCTGTATCTG -3'
Posted On2020-07-28