Incidental Mutation 'R8297:Robo2'
ID639041
Institutional Source Beutler Lab
Gene Symbol Robo2
Ensembl Gene ENSMUSG00000052516
Gene Nameroundabout guidance receptor 2
Synonyms9430089E08Rik, 2600013A04Rik, D230004I22Rik
Accession Numbers

Ncbi RefSeq: NM_175549.4; MGI:1890110

Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R8297 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location73891839-74411825 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 74015926 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 293 (C293*)
Ref Sequence ENSEMBL: ENSMUSP00000112776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117200] [ENSMUST00000117785]
Predicted Effect probably null
Transcript: ENSMUST00000116586
AA Change: C293*
SMART Domains Protein: ENSMUSP00000112285
Gene: ENSMUSG00000052516
AA Change: C293*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 330 402 1.3e-11 SMART
IGc2 434 499 3.73e-12 SMART
FN3 526 608 1.42e-15 SMART
FN3 640 725 3.54e-2 SMART
FN3 740 827 6.15e-11 SMART
transmembrane domain 864 886 N/A INTRINSIC
low complexity region 1044 1069 N/A INTRINSIC
low complexity region 1076 1087 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117200
AA Change: C293*
SMART Domains Protein: ENSMUSP00000113795
Gene: ENSMUSG00000052516
AA Change: C293*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1040 1065 N/A INTRINSIC
low complexity region 1072 1083 N/A INTRINSIC
low complexity region 1191 1199 N/A INTRINSIC
low complexity region 1210 1234 N/A INTRINSIC
low complexity region 1318 1342 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117785
AA Change: C293*
SMART Domains Protein: ENSMUSP00000112776
Gene: ENSMUSG00000052516
AA Change: C293*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1072 1107 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1233 1241 N/A INTRINSIC
low complexity region 1252 1276 N/A INTRINSIC
low complexity region 1351 1362 N/A INTRINSIC
low complexity region 1451 1475 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype Strain: 3759448; 3043127
Lethality: D1
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ROBO family, part of the immunoglobulin superfamily of proteins that are highly conserved from fly to human. The encoded protein is a transmembrane receptor for the slit homolog 2 protein and functions in axon guidance and cell migration. Mutations in this gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutants display postnatal lethality, abnormal ureteric bud development, multiple fused kidneys, multiple ureters, and abnormal commissural axon growth. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(3) Gene trapped(3)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T C 10: 21,621,679 L73P probably damaging Het
4933412E24Rik T G 15: 60,015,675 R305S probably damaging Het
Adamts19 T A 18: 58,837,848 V168E probably damaging Het
Ankrd34b T A 13: 92,439,589 L443Q probably damaging Het
Ano3 A G 2: 110,661,271 Y887H probably damaging Het
Arhgef2 A T 3: 88,639,432 H553L probably benign Het
Atxn1 G T 13: 45,567,029 N463K probably benign Het
Birc6 A G 17: 74,625,104 probably null Het
C4bp A G 1: 130,636,745 S401P probably damaging Het
Cd5 T A 19: 10,720,245 R457W probably damaging Het
Chek2 T G 5: 110,848,436 Y127D probably damaging Het
Clec4a1 G A 6: 122,922,001 V10M probably damaging Het
Cltc A G 11: 86,712,631 Y790H probably damaging Het
Cops2 T C 2: 125,859,108 probably benign Het
Cyb5d2 A G 11: 72,789,103 F122S probably damaging Het
Daam1 T A 12: 71,951,915 L548H unknown Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dsg1a A C 18: 20,332,033 N427T probably benign Het
Ear14 A T 14: 51,204,107 D140V probably damaging Het
Epha4 A C 1: 77,506,910 F154C probably damaging Het
Ets2 G A 16: 95,706,454 V12M probably damaging Het
Fbxo40 G A 16: 36,969,308 T480I probably damaging Het
Fdps A T 3: 89,093,741 Y322N probably damaging Het
Gca T C 2: 62,686,356 M132T probably benign Het
Ifi203 T G 1: 173,937,930 K26T probably damaging Het
Itga10 A G 3: 96,654,800 R668G probably damaging Het
Itgal T C 7: 127,330,466 I1185T unknown Het
Kcnj13 A T 1: 87,386,467 N344K probably damaging Het
Kdm5a A T 6: 120,381,555 L186F probably benign Het
Klhl8 T C 5: 103,863,088 N624D probably benign Het
Klrb1 G T 6: 128,712,259 T83K possibly damaging Het
Krt77 TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 15: 101,859,972 probably benign Het
Ltb G T 17: 35,194,679 R53L probably benign Het
Mterf3 A G 13: 66,907,158 V69A Het
Mvb12a A G 8: 71,545,244 K101E probably damaging Het
Nbeal2 T A 9: 110,635,341 Q1110L possibly damaging Het
Neb T A 2: 52,308,763 T389S possibly damaging Het
Nol4 A G 18: 23,040,012 F11L probably damaging Het
Olfr132 A G 17: 38,130,593 S200P probably damaging Het
Olfr441 A G 6: 43,116,506 I255V probably benign Het
Olfr675 C T 7: 105,024,678 G97R probably benign Het
Olfr9 T C 10: 128,990,839 L309P possibly damaging Het
Pde2a T A 7: 101,504,673 Y487N possibly damaging Het
Pde4a C T 9: 21,166,108 P61S possibly damaging Het
Pramef25 T A 4: 143,949,120 T379S probably benign Het
Prr5l A G 2: 101,741,285 probably null Het
Ptpn6 G A 6: 124,728,651 T179I possibly damaging Het
Ralyl T C 3: 14,039,776 S34P probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rtn4 T G 11: 29,705,536 D169E probably damaging Het
Slc22a22 A T 15: 57,259,110 V157E probably damaging Het
Sytl2 A G 7: 90,385,075 T498A probably benign Het
Tgm6 G A 2: 130,137,438 V163I probably benign Het
Tnpo3 A T 6: 29,582,303 C187S possibly damaging Het
Ttn A G 2: 76,786,141 probably null Het
Vangl2 C A 1: 172,009,946 V99F possibly damaging Het
Vmn1r167 C T 7: 23,504,790 C267Y probably damaging Het
Vsig10l T C 7: 43,464,107 V161A possibly damaging Het
Xrcc5 G A 1: 72,325,085 R232Q possibly damaging Het
Xrcc6 C G 15: 82,029,262 F365L probably damaging Het
Zcchc11 G A 4: 108,479,708 A210T possibly damaging Het
Zdhhc13 A G 7: 48,815,509 Y389C probably damaging Het
Other mutations in Robo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Robo2 APN 16 73961700 missense probably benign
IGL00849:Robo2 APN 16 73973777 missense possibly damaging 0.80
IGL00908:Robo2 APN 16 73985691 missense probably damaging 0.98
IGL00944:Robo2 APN 16 73933697 missense possibly damaging 0.92
IGL00955:Robo2 APN 16 74015972 missense probably damaging 1.00
IGL00970:Robo2 APN 16 73897046 missense probably benign 0.00
IGL01020:Robo2 APN 16 73928151 missense probably benign 0.06
IGL01347:Robo2 APN 16 74352856 missense probably damaging 1.00
IGL02280:Robo2 APN 16 74046816 missense probably damaging 1.00
IGL02424:Robo2 APN 16 73973301 missense possibly damaging 0.89
IGL03376:Robo2 APN 16 73956492 missense probably damaging 1.00
LCD18:Robo2 UTSW 16 74055954 intron probably benign
P0018:Robo2 UTSW 16 74046806 missense possibly damaging 0.82
R0314:Robo2 UTSW 16 73956637 missense probably damaging 1.00
R0324:Robo2 UTSW 16 73967851 missense probably damaging 1.00
R0539:Robo2 UTSW 16 73985574 splice site probably benign
R0620:Robo2 UTSW 16 73967802 missense possibly damaging 0.92
R0630:Robo2 UTSW 16 73916205 missense probably benign 0.05
R0701:Robo2 UTSW 16 74046874 missense probably damaging 1.00
R1155:Robo2 UTSW 16 74035108 missense probably damaging 1.00
R1168:Robo2 UTSW 16 73948296 missense probably damaging 1.00
R1195:Robo2 UTSW 16 73916128 splice site probably null
R1195:Robo2 UTSW 16 73916128 splice site probably null
R1195:Robo2 UTSW 16 73916128 splice site probably null
R1317:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1422:Robo2 UTSW 16 73978448 missense probably damaging 0.99
R1452:Robo2 UTSW 16 73961910 missense probably damaging 1.00
R1649:Robo2 UTSW 16 73899001 missense probably benign 0.36
R1709:Robo2 UTSW 16 73956523 missense possibly damaging 0.83
R1751:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1761:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1885:Robo2 UTSW 16 73916145 missense probably benign 0.00
R1911:Robo2 UTSW 16 73958325 missense probably damaging 1.00
R1919:Robo2 UTSW 16 73899154 missense probably benign
R2005:Robo2 UTSW 16 73933115 missense possibly damaging 0.82
R2851:Robo2 UTSW 16 73961888 missense probably damaging 1.00
R3732:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3732:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3733:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3734:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3913:Robo2 UTSW 16 74035005 missense probably damaging 1.00
R3956:Robo2 UTSW 16 73961867 missense probably damaging 1.00
R4394:Robo2 UTSW 16 73948379 missense probably benign 0.13
R4426:Robo2 UTSW 16 73948266 missense probably damaging 1.00
R4437:Robo2 UTSW 16 73973244 missense possibly damaging 0.88
R4454:Robo2 UTSW 16 74352519 intron probably benign
R4478:Robo2 UTSW 16 74015873 missense probably damaging 1.00
R4586:Robo2 UTSW 16 73961873 missense probably damaging 0.96
R4621:Robo2 UTSW 16 73985933 missense probably benign 0.00
R4673:Robo2 UTSW 16 73904378 splice site probably null
R4798:Robo2 UTSW 16 74352745 missense probably damaging 1.00
R4812:Robo2 UTSW 16 73916288 missense probably benign 0.00
R4855:Robo2 UTSW 16 73971191 missense probably damaging 1.00
R4910:Robo2 UTSW 16 73933778 missense probably damaging 0.99
R4916:Robo2 UTSW 16 73898915 missense possibly damaging 0.53
R4948:Robo2 UTSW 16 74352838 missense possibly damaging 0.88
R5325:Robo2 UTSW 16 73973785 missense possibly damaging 0.72
R5326:Robo2 UTSW 16 73898965 missense probably benign 0.20
R5447:Robo2 UTSW 16 73973766 nonsense probably null
R5542:Robo2 UTSW 16 73898965 missense probably benign 0.20
R5545:Robo2 UTSW 16 73961747 missense probably damaging 1.00
R5646:Robo2 UTSW 16 73961819 missense probably damaging 0.99
R5734:Robo2 UTSW 16 74352784 missense probably damaging 1.00
R5892:Robo2 UTSW 16 73895780 utr 3 prime probably benign
R5960:Robo2 UTSW 16 73933715 missense probably damaging 1.00
R6126:Robo2 UTSW 16 73920682 missense probably benign 0.00
R6130:Robo2 UTSW 16 73920682 missense probably benign 0.00
R6153:Robo2 UTSW 16 73920729 missense probably damaging 1.00
R6240:Robo2 UTSW 16 73982139 missense probably damaging 1.00
R6247:Robo2 UTSW 16 73967784 missense probably damaging 1.00
R6304:Robo2 UTSW 16 73958308 missense probably damaging 1.00
R6337:Robo2 UTSW 16 73928151 missense probably benign 0.06
R6431:Robo2 UTSW 16 74046809 nonsense probably null
R6440:Robo2 UTSW 16 73916122 missense probably benign 0.31
R6596:Robo2 UTSW 16 73971108 missense probably damaging 1.00
R6919:Robo2 UTSW 16 73961867 missense probably damaging 1.00
R6927:Robo2 UTSW 16 73982058 missense probably damaging 1.00
R7029:Robo2 UTSW 16 73948337 missense probably damaging 1.00
R7078:Robo2 UTSW 16 74352616 missense probably damaging 1.00
R7092:Robo2 UTSW 16 73956643 missense probably damaging 0.99
R7136:Robo2 UTSW 16 73956550 missense probably damaging 0.99
R7192:Robo2 UTSW 16 73920750 missense probably benign 0.19
R7569:Robo2 UTSW 16 74035115 missense possibly damaging 0.82
R7686:Robo2 UTSW 16 73958405 missense probably damaging 1.00
R7720:Robo2 UTSW 16 73897015 missense probably benign 0.00
R7772:Robo2 UTSW 16 73961889 missense probably benign 0.24
R7822:Robo2 UTSW 16 73973171 missense probably damaging 1.00
R7849:Robo2 UTSW 16 73973244 missense possibly damaging 0.88
R7881:Robo2 UTSW 16 73920697 missense probably benign 0.00
R7897:Robo2 UTSW 16 73898950 missense probably benign
R8135:Robo2 UTSW 16 73933160 missense probably benign 0.04
R8307:Robo2 UTSW 16 73956610 missense probably damaging 1.00
R8379:Robo2 UTSW 16 73933700 missense probably damaging 0.99
R8393:Robo2 UTSW 16 73978494 missense probably damaging 1.00
X0063:Robo2 UTSW 16 74045828 missense probably damaging 1.00
Z1176:Robo2 UTSW 16 73933591 missense probably benign 0.35
Z1177:Robo2 UTSW 16 73940299 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGTGTTAGGCGTGCCACATG -3'
(R):5'- CTGACAAGCAACTAGTAGTGGG -3'

Sequencing Primer
(F):5'- GCCCAGCAGCTCCTTCTATTTTAAG -3'
(R):5'- AAGCAACTAGTAGTGGGTTATAAAAC -3'
Posted On2020-07-28