Incidental Mutation 'R8297:Ltb'
ID639043
Institutional Source Beutler Lab
Gene Symbol Ltb
Ensembl Gene ENSMUSG00000024399
Gene Namelymphotoxin B
Synonymslymphotoxin beta, LTbeta, p33, Tnfsf3, Tnfc
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R8297 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location35194439-35196320 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 35194679 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 53 (R53L)
Ref Sequence ENSEMBL: ENSMUSP00000025262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025262] [ENSMUST00000025263] [ENSMUST00000167924] [ENSMUST00000173600]
Predicted Effect probably benign
Transcript: ENSMUST00000025262
AA Change: R53L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000025262
Gene: ENSMUSG00000024399
AA Change: R53L

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
TNF 154 305 8.76e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000025263
SMART Domains Protein: ENSMUSP00000025263
Gene: ENSMUSG00000024401

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
TNF 91 235 1.59e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167924
SMART Domains Protein: ENSMUSP00000126122
Gene: ENSMUSG00000024401

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
TNF 74 219 2.8e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173600
SMART Domains Protein: ENSMUSP00000134706
Gene: ENSMUSG00000024399

DomainStartEndE-ValueType
TNF 33 184 8.76e-42 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Lymphotoxin beta is a type II membrane protein of the TNF family. It anchors lymphotoxin-alpha to the cell surface through heterotrimer formation. The predominant form on the lymphocyte surface is the lymphotoxin-alpha 1/beta 2 complex (e.g. 1 molecule alpha/2 molecules beta) and this complex is the primary ligand for the lymphotoxin-beta receptor. The minor complex is lymphotoxin-alpha 2/beta 1. LTB is an inducer of the inflammatory response system and involved in normal development of lymphoid tissue. Lymphotoxin-beta isoform b is unable to complex with lymphotoxin-alpha suggesting a function for lymphotoxin-beta which is independent of lympyhotoxin-alpha. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations lack peripheral lymph nodes, Peyer's patches, splenic germinal centers and follicular dendritic cells. Mutants exhibit lymphocytosis in the circulation and peritoneal cavity with infiltrations of the lung and liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T C 10: 21,621,679 L73P probably damaging Het
4933412E24Rik T G 15: 60,015,675 R305S probably damaging Het
Adamts19 T A 18: 58,837,848 V168E probably damaging Het
Ankrd34b T A 13: 92,439,589 L443Q probably damaging Het
Ano3 A G 2: 110,661,271 Y887H probably damaging Het
Arhgef2 A T 3: 88,639,432 H553L probably benign Het
Atxn1 G T 13: 45,567,029 N463K probably benign Het
Birc6 A G 17: 74,625,104 probably null Het
C4bp A G 1: 130,636,745 S401P probably damaging Het
Cd5 T A 19: 10,720,245 R457W probably damaging Het
Chek2 T G 5: 110,848,436 Y127D probably damaging Het
Clec4a1 G A 6: 122,922,001 V10M probably damaging Het
Cltc A G 11: 86,712,631 Y790H probably damaging Het
Cops2 T C 2: 125,859,108 probably benign Het
Cyb5d2 A G 11: 72,789,103 F122S probably damaging Het
Daam1 T A 12: 71,951,915 L548H unknown Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dsg1a A C 18: 20,332,033 N427T probably benign Het
Ear14 A T 14: 51,204,107 D140V probably damaging Het
Epha4 A C 1: 77,506,910 F154C probably damaging Het
Ets2 G A 16: 95,706,454 V12M probably damaging Het
Fbxo40 G A 16: 36,969,308 T480I probably damaging Het
Fdps A T 3: 89,093,741 Y322N probably damaging Het
Gca T C 2: 62,686,356 M132T probably benign Het
Ifi203 T G 1: 173,937,930 K26T probably damaging Het
Itga10 A G 3: 96,654,800 R668G probably damaging Het
Itgal T C 7: 127,330,466 I1185T unknown Het
Kcnj13 A T 1: 87,386,467 N344K probably damaging Het
Kdm5a A T 6: 120,381,555 L186F probably benign Het
Klhl8 T C 5: 103,863,088 N624D probably benign Het
Klrb1 G T 6: 128,712,259 T83K possibly damaging Het
Krt77 TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 15: 101,859,972 probably benign Het
Mterf3 A G 13: 66,907,158 V69A Het
Mvb12a A G 8: 71,545,244 K101E probably damaging Het
Nbeal2 T A 9: 110,635,341 Q1110L possibly damaging Het
Neb T A 2: 52,308,763 T389S possibly damaging Het
Nol4 A G 18: 23,040,012 F11L probably damaging Het
Olfr132 A G 17: 38,130,593 S200P probably damaging Het
Olfr441 A G 6: 43,116,506 I255V probably benign Het
Olfr675 C T 7: 105,024,678 G97R probably benign Het
Olfr9 T C 10: 128,990,839 L309P possibly damaging Het
Pde2a T A 7: 101,504,673 Y487N possibly damaging Het
Pde4a C T 9: 21,166,108 P61S possibly damaging Het
Pramef25 T A 4: 143,949,120 T379S probably benign Het
Prr5l A G 2: 101,741,285 probably null Het
Ptpn6 G A 6: 124,728,651 T179I possibly damaging Het
Ralyl T C 3: 14,039,776 S34P probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Robo2 A T 16: 74,015,926 C293* probably null Het
Rtn4 T G 11: 29,705,536 D169E probably damaging Het
Slc22a22 A T 15: 57,259,110 V157E probably damaging Het
Sytl2 A G 7: 90,385,075 T498A probably benign Het
Tgm6 G A 2: 130,137,438 V163I probably benign Het
Tnpo3 A T 6: 29,582,303 C187S possibly damaging Het
Ttn A G 2: 76,786,141 probably null Het
Vangl2 C A 1: 172,009,946 V99F possibly damaging Het
Vmn1r167 C T 7: 23,504,790 C267Y probably damaging Het
Vsig10l T C 7: 43,464,107 V161A possibly damaging Het
Xrcc5 G A 1: 72,325,085 R232Q possibly damaging Het
Xrcc6 C G 15: 82,029,262 F365L probably damaging Het
Zcchc11 G A 4: 108,479,708 A210T possibly damaging Het
Zdhhc13 A G 7: 48,815,509 Y389C probably damaging Het
Other mutations in Ltb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Ltb APN 17 35194666 missense possibly damaging 0.78
IGL01112:Ltb APN 17 35194600 missense probably benign 0.04
IGL02263:Ltb APN 17 35196001 missense probably damaging 1.00
IGL02983:Ltb APN 17 35194670 missense probably benign 0.15
IGL02995:Ltb APN 17 35195372 splice site probably benign
IGL03389:Ltb APN 17 35195068 missense probably benign 0.00
R0103:Ltb UTSW 17 35195040 intron probably benign
R0103:Ltb UTSW 17 35195040 intron probably benign
R2060:Ltb UTSW 17 35195763 missense probably damaging 0.97
R4718:Ltb UTSW 17 35195337 splice site probably null
R4823:Ltb UTSW 17 35195230 missense probably benign
R4884:Ltb UTSW 17 35195258 missense probably benign
R5231:Ltb UTSW 17 35195826 missense probably damaging 1.00
R5327:Ltb UTSW 17 35195959 missense probably damaging 1.00
R8344:Ltb UTSW 17 35195193 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CTGAGGTATGAAAGCCCCTG -3'
(R):5'- TGCAGTGTTATCTGGAAAAGAAGC -3'

Sequencing Primer
(F):5'- CCCCGGTCCTAGTTCTGAG -3'
(R):5'- TGTTATCTGGAAAAGAAGCCAACC -3'
Posted On2020-07-28