Incidental Mutation 'R8297:Rftn1'
ID639045
Institutional Source Beutler Lab
Gene Symbol Rftn1
Ensembl Gene ENSMUSG00000039316
Gene Nameraftlin lipid raft linker 1
Synonyms2310015N21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R8297 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location49992257-50190674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 50047380 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 318 (A318D)
Ref Sequence ENSEMBL: ENSMUSP00000046524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044503] [ENSMUST00000113195]
Predicted Effect probably damaging
Transcript: ENSMUST00000044503
AA Change: A318D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046524
Gene: ENSMUSG00000039316
AA Change: A318D

DomainStartEndE-ValueType
Pfam:Raftlin 1 473 1.3e-219 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113195
AA Change: A40D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108820
Gene: ENSMUSG00000039316
AA Change: A40D

DomainStartEndE-ValueType
Pfam:Raftlin 1 207 1.5e-104 PFAM
Meta Mutation Damage Score 0.3897 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for null mutations have defects in T cell activation, T cell help to B cells, and Th17 differentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T C 10: 21,621,679 L73P probably damaging Het
4933412E24Rik T G 15: 60,015,675 R305S probably damaging Het
Adamts19 T A 18: 58,837,848 V168E probably damaging Het
Ankrd34b T A 13: 92,439,589 L443Q probably damaging Het
Ano3 A G 2: 110,661,271 Y887H probably damaging Het
Arhgef2 A T 3: 88,639,432 H553L probably benign Het
Atxn1 G T 13: 45,567,029 N463K probably benign Het
Birc6 A G 17: 74,625,104 probably null Het
C4bp A G 1: 130,636,745 S401P probably damaging Het
Cd5 T A 19: 10,720,245 R457W probably damaging Het
Chek2 T G 5: 110,848,436 Y127D probably damaging Het
Clec4a1 G A 6: 122,922,001 V10M probably damaging Het
Cltc A G 11: 86,712,631 Y790H probably damaging Het
Cops2 T C 2: 125,859,108 probably benign Het
Cyb5d2 A G 11: 72,789,103 F122S probably damaging Het
Daam1 T A 12: 71,951,915 L548H unknown Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dsg1a A C 18: 20,332,033 N427T probably benign Het
Ear14 A T 14: 51,204,107 D140V probably damaging Het
Epha4 A C 1: 77,506,910 F154C probably damaging Het
Ets2 G A 16: 95,706,454 V12M probably damaging Het
Fbxo40 G A 16: 36,969,308 T480I probably damaging Het
Fdps A T 3: 89,093,741 Y322N probably damaging Het
Gca T C 2: 62,686,356 M132T probably benign Het
Ifi203 T G 1: 173,937,930 K26T probably damaging Het
Itga10 A G 3: 96,654,800 R668G probably damaging Het
Itgal T C 7: 127,330,466 I1185T unknown Het
Kcnj13 A T 1: 87,386,467 N344K probably damaging Het
Kdm5a A T 6: 120,381,555 L186F probably benign Het
Klhl8 T C 5: 103,863,088 N624D probably benign Het
Klrb1 G T 6: 128,712,259 T83K possibly damaging Het
Krt77 TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 15: 101,859,972 probably benign Het
Ltb G T 17: 35,194,679 R53L probably benign Het
Mterf3 A G 13: 66,907,158 V69A Het
Mvb12a A G 8: 71,545,244 K101E probably damaging Het
Nbeal2 T A 9: 110,635,341 Q1110L possibly damaging Het
Neb T A 2: 52,308,763 T389S possibly damaging Het
Nol4 A G 18: 23,040,012 F11L probably damaging Het
Olfr132 A G 17: 38,130,593 S200P probably damaging Het
Olfr441 A G 6: 43,116,506 I255V probably benign Het
Olfr675 C T 7: 105,024,678 G97R probably benign Het
Olfr9 T C 10: 128,990,839 L309P possibly damaging Het
Pde2a T A 7: 101,504,673 Y487N possibly damaging Het
Pde4a C T 9: 21,166,108 P61S possibly damaging Het
Pramef25 T A 4: 143,949,120 T379S probably benign Het
Prr5l A G 2: 101,741,285 probably null Het
Ptpn6 G A 6: 124,728,651 T179I possibly damaging Het
Ralyl T C 3: 14,039,776 S34P probably benign Het
Robo2 A T 16: 74,015,926 C293* probably null Het
Rtn4 T G 11: 29,705,536 D169E probably damaging Het
Slc22a22 A T 15: 57,259,110 V157E probably damaging Het
Sytl2 A G 7: 90,385,075 T498A probably benign Het
Tgm6 G A 2: 130,137,438 V163I probably benign Het
Tnpo3 A T 6: 29,582,303 C187S possibly damaging Het
Ttn A G 2: 76,786,141 probably null Het
Vangl2 C A 1: 172,009,946 V99F possibly damaging Het
Vmn1r167 C T 7: 23,504,790 C267Y probably damaging Het
Vsig10l T C 7: 43,464,107 V161A possibly damaging Het
Xrcc5 G A 1: 72,325,085 R232Q possibly damaging Het
Xrcc6 C G 15: 82,029,262 F365L probably damaging Het
Zcchc11 G A 4: 108,479,708 A210T possibly damaging Het
Zdhhc13 A G 7: 48,815,509 Y389C probably damaging Het
Other mutations in Rftn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Rftn1 APN 17 50055377 missense probably benign 0.01
IGL02318:Rftn1 APN 17 50036970 missense possibly damaging 0.95
IGL02568:Rftn1 APN 17 50036999 missense probably damaging 1.00
IGL02873:Rftn1 APN 17 50169152 utr 5 prime probably benign
IGL02965:Rftn1 APN 17 50055252 missense probably benign 0.32
BB001:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
BB003:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
BB004:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
BB005:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
BB011:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
BB013:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
BB014:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
BB015:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R0544:Rftn1 UTSW 17 49994261 missense possibly damaging 0.71
R2219:Rftn1 UTSW 17 50169145 start codon destroyed probably null 1.00
R4542:Rftn1 UTSW 17 50055231 splice site probably null
R5318:Rftn1 UTSW 17 49994458 missense probably benign 0.09
R5605:Rftn1 UTSW 17 50047407 missense probably damaging 1.00
R5700:Rftn1 UTSW 17 50002669 missense probably damaging 1.00
R5853:Rftn1 UTSW 17 50047326 missense probably damaging 1.00
R6459:Rftn1 UTSW 17 50047306 missense probably benign 0.02
R6994:Rftn1 UTSW 17 50036991 missense possibly damaging 0.82
R7210:Rftn1 UTSW 17 49994307 nonsense probably null
R7283:Rftn1 UTSW 17 50047441 missense probably damaging 1.00
R7348:Rftn1 UTSW 17 50004323 missense probably damaging 1.00
R7444:Rftn1 UTSW 17 50047407 missense probably damaging 1.00
R7684:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R7685:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R7686:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R7881:Rftn1 UTSW 17 50047435 missense probably benign 0.08
R7924:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R7926:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R7927:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R7928:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R7943:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8052:Rftn1 UTSW 17 50086579 missense probably damaging 0.98
R8162:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8164:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8248:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8249:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8250:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8271:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8272:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8273:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8296:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8300:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8315:Rftn1 UTSW 17 50002637 missense possibly damaging 0.50
Z1176:Rftn1 UTSW 17 50169003 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCCTTTGTGAGATCTGCC -3'
(R):5'- AAATTGGTTCTGTGGGCTAACC -3'

Sequencing Primer
(F):5'- TGAGATCTGCCCAAGCTATG -3'
(R):5'- GGTTCTGTGGGCTAACCTCTCTC -3'
Posted On2020-07-28