Mutagenetix > Incidental Mutation

Incidental Mutation 'R8297:Adamts19'

639049

Institutional Source

Beutler Lab

Gene Symbol

Adamts19

Ensembl Gene

ENSMUSG00000053441

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19

Synonyms

D230034E10Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8297 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58836764-59053678 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 58837848 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 168 (V168E)

Ref Sequence

ENSEMBL: ENSMUSP00000050535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052907]

AlphaFold

P59509

Predicted Effect

probably damaging
Transcript: ENSMUST00000052907
AA Change: V168E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: V168E

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	57	84	N/A	INTRINSIC
low complexity region	109	124	N/A	INTRINSIC
Pfam:Pep_M12B_propep	131	276	1.6e-21	PFAM
Pfam:Reprolysin_5	326	523	1.7e-13	PFAM
Pfam:Reprolysin_4	328	544	2e-10	PFAM
Pfam:Reprolysin	328	548	9e-22	PFAM
Pfam:Reprolysin_2	346	537	1.6e-9	PFAM
Pfam:Reprolysin_3	350	496	3.4e-12	PFAM
low complexity region	551	562	N/A	INTRINSIC
TSP1	639	689	5.68e-9	SMART
Pfam:ADAM_spacer1	793	903	1.1e-31	PFAM
TSP1	922	980	4.95e-2	SMART
TSP1	982	1040	4.95e-2	SMART
TSP1	1042	1086	1.62e-4	SMART
TSP1	1093	1147	1.03e-6	SMART
Pfam:PLAC	1167	1199	4.2e-9	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N01Rik	T	C	10: 21,621,679	L73P	probably damaging	Het
4933412E24Rik	T	G	15: 60,015,675	R305S	probably damaging	Het
Ankrd34b	T	A	13: 92,439,589	L443Q	probably damaging	Het
Ano3	A	G	2: 110,661,271	Y887H	probably damaging	Het
Arhgef2	A	T	3: 88,639,432	H553L	probably benign	Het
Atxn1	G	T	13: 45,567,029	N463K	probably benign	Het
Birc6	A	G	17: 74,625,104		probably null	Het
C4bp	A	G	1: 130,636,745	S401P	probably damaging	Het
Cd5	T	A	19: 10,720,245	R457W	probably damaging	Het
Chek2	T	G	5: 110,848,436	Y127D	probably damaging	Het
Clec4a1	G	A	6: 122,922,001	V10M	probably damaging	Het
Cltc	A	G	11: 86,712,631	Y790H	probably damaging	Het
Cops2	T	C	2: 125,859,108		probably benign	Het
Cyb5d2	A	G	11: 72,789,103	F122S	probably damaging	Het
Daam1	T	A	12: 71,951,915	L548H	unknown	Het
Dcp1a	A	G	14: 30,522,926	T570A	possibly damaging	Het
Dsg1a	A	C	18: 20,332,033	N427T	probably benign	Het
Ear14	A	T	14: 51,204,107	D140V	probably damaging	Het
Epha4	A	C	1: 77,506,910	F154C	probably damaging	Het
Ets2	G	A	16: 95,706,454	V12M	probably damaging	Het
Fbxo40	G	A	16: 36,969,308	T480I	probably damaging	Het
Fdps	A	T	3: 89,093,741	Y322N	probably damaging	Het
Gca	T	C	2: 62,686,356	M132T	probably benign	Het
Ifi203	T	G	1: 173,937,930	K26T	probably damaging	Het
Itga10	A	G	3: 96,654,800	R668G	probably damaging	Het
Itgal	T	C	7: 127,330,466	I1185T	unknown	Het
Kcnj13	A	T	1: 87,386,467	N344K	probably damaging	Het
Kdm5a	A	T	6: 120,381,555	L186F	probably benign	Het
Klhl8	T	C	5: 103,863,088	N624D	probably benign	Het
Klrb1	G	T	6: 128,712,259	T83K	possibly damaging	Het
Krt77	TGCCGCCGCCGCCGCCGCCGCCGCCGC	TGCCGCCGCCGCCGCCGCCGCCGC	15: 101,859,972		probably benign	Het
Ltb	G	T	17: 35,194,679	R53L	probably benign	Het
Mterf3	A	G	13: 66,907,158	V69A		Het
Mvb12a	A	G	8: 71,545,244	K101E	probably damaging	Het
Nbeal2	T	A	9: 110,635,341	Q1110L	possibly damaging	Het
Neb	T	A	2: 52,308,763	T389S	possibly damaging	Het
Nol4	A	G	18: 23,040,012	F11L	probably damaging	Het
Olfr132	A	G	17: 38,130,593	S200P	probably damaging	Het
Olfr441	A	G	6: 43,116,506	I255V	probably benign	Het
Olfr675	C	T	7: 105,024,678	G97R	probably benign	Het
Olfr9	T	C	10: 128,990,839	L309P	possibly damaging	Het
Pde2a	T	A	7: 101,504,673	Y487N	possibly damaging	Het
Pde4a	C	T	9: 21,166,108	P61S	possibly damaging	Het
Pramef25	T	A	4: 143,949,120	T379S	probably benign	Het
Prr5l	A	G	2: 101,741,285		probably null	Het
Ptpn6	G	A	6: 124,728,651	T179I	possibly damaging	Het
Ralyl	T	C	3: 14,039,776	S34P	probably benign	Het
Rftn1	G	T	17: 50,047,380	A318D	probably damaging	Het
Robo2	A	T	16: 74,015,926	C293*	probably null	Het
Rtn4	T	G	11: 29,705,536	D169E	probably damaging	Het
Slc22a22	A	T	15: 57,259,110	V157E	probably damaging	Het
Sytl2	A	G	7: 90,385,075	T498A	probably benign	Het
Tgm6	G	A	2: 130,137,438	V163I	probably benign	Het
Tnpo3	A	T	6: 29,582,303	C187S	possibly damaging	Het
Ttn	A	G	2: 76,786,141		probably null	Het
Vangl2	C	A	1: 172,009,946	V99F	possibly damaging	Het
Vmn1r167	C	T	7: 23,504,790	C267Y	probably damaging	Het
Vsig10l	T	C	7: 43,464,107	V161A	possibly damaging	Het
Xrcc5	G	A	1: 72,325,085	R232Q	possibly damaging	Het
Xrcc6	C	G	15: 82,029,262	F365L	probably damaging	Het
Zcchc11	G	A	4: 108,479,708	A210T	possibly damaging	Het
Zdhhc13	A	G	7: 48,815,509	Y389C	probably damaging	Het

Other mutations in Adamts19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Adamts19	APN	18	59024465	missense	probably damaging	1.00
IGL00331:Adamts19	APN	18	59007325	splice site	probably benign
IGL00970:Adamts19	APN	18	59011077	missense	possibly damaging	0.82
IGL01328:Adamts19	APN	18	59048882	missense	possibly damaging	0.89
IGL01385:Adamts19	APN	18	58972779	missense	probably damaging	0.98
IGL01529:Adamts19	APN	18	58963463	missense	probably damaging	0.99
IGL01535:Adamts19	APN	18	58968819	missense	probably benign	0.00
IGL01557:Adamts19	APN	18	58968720	splice site	probably null
IGL01705:Adamts19	APN	18	59032966	missense	possibly damaging	0.91
IGL01803:Adamts19	APN	18	58952469	missense	probably damaging	1.00
IGL02116:Adamts19	APN	18	58837499	missense	probably benign
IGL02131:Adamts19	APN	18	59052660	missense	probably damaging	1.00
IGL02312:Adamts19	APN	18	58927297	missense	probably damaging	1.00
IGL02755:Adamts19	APN	18	58969933	missense	probably benign	0.25
IGL02866:Adamts19	APN	18	59048842	missense	possibly damaging	0.80
IGL02964:Adamts19	APN	18	58988965	missense	probably damaging	1.00
IGL02982:Adamts19	APN	18	59024518	missense	probably damaging	1.00
IGL03040:Adamts19	APN	18	58903008	missense	probably benign	0.05
R0081:Adamts19	UTSW	18	58903065	critical splice donor site	probably null
R0194:Adamts19	UTSW	18	59011148	missense	probably null	1.00
R0195:Adamts19	UTSW	18	58969870	splice site	probably benign
R0541:Adamts19	UTSW	18	58927300	critical splice donor site	probably null
R0659:Adamts19	UTSW	18	59007493	splice site	probably benign
R0967:Adamts19	UTSW	18	58972740	nonsense	probably null
R1512:Adamts19	UTSW	18	59048845	missense	possibly damaging	0.89
R1536:Adamts19	UTSW	18	59052615	missense	probably damaging	1.00
R1582:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R1629:Adamts19	UTSW	18	58954619	missense	probably damaging	0.97
R1653:Adamts19	UTSW	18	58890293	missense	probably benign	0.00
R1718:Adamts19	UTSW	18	58972825	missense	probably damaging	1.00
R1733:Adamts19	UTSW	18	59031929	missense	probably damaging	1.00
R1753:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R1776:Adamts19	UTSW	18	58954620	missense	probably damaging	1.00
R1905:Adamts19	UTSW	18	59032945	missense	possibly damaging	0.92
R1958:Adamts19	UTSW	18	58970006	missense	probably benign	0.09
R1994:Adamts19	UTSW	18	58972831	critical splice donor site	probably null
R2177:Adamts19	UTSW	18	58954554	missense	possibly damaging	0.66
R3730:Adamts19	UTSW	18	58900910	missense	probably damaging	1.00
R4342:Adamts19	UTSW	18	58942500	missense	probably damaging	1.00
R4772:Adamts19	UTSW	18	58837776	missense	possibly damaging	0.85
R4822:Adamts19	UTSW	18	58890284	missense	probably damaging	1.00
R4891:Adamts19	UTSW	18	59033000	missense	probably damaging	1.00
R5112:Adamts19	UTSW	18	59031804	nonsense	probably null
R5116:Adamts19	UTSW	18	58902994	missense	possibly damaging	0.52
R5205:Adamts19	UTSW	18	58968808	missense	probably damaging	1.00
R5765:Adamts19	UTSW	18	59052582	missense	probably damaging	1.00
R5781:Adamts19	UTSW	18	58837968	missense	possibly damaging	0.59
R5792:Adamts19	UTSW	18	58837512	missense	possibly damaging	0.49
R6082:Adamts19	UTSW	18	58968774	missense	probably benign	0.18
R6088:Adamts19	UTSW	18	58902102	missense	probably damaging	1.00
R7060:Adamts19	UTSW	18	58837640	nonsense	probably null
R7251:Adamts19	UTSW	18	58837902	missense	probably damaging	1.00
R7295:Adamts19	UTSW	18	58837883	missense	probably damaging	1.00
R7974:Adamts19	UTSW	18	59011022	missense	possibly damaging	0.72
R7991:Adamts19	UTSW	18	59052654	missense	probably damaging	1.00
R8129:Adamts19	UTSW	18	59007487	critical splice donor site	probably null
R8336:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R8358:Adamts19	UTSW	18	59048809	missense	probably damaging	1.00
R8864:Adamts19	UTSW	18	58890425	nonsense	probably null
R9051:Adamts19	UTSW	18	58900976	missense	probably damaging	1.00
R9253:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R9423:Adamts19	UTSW	18	58890355	missense	possibly damaging	0.89
R9610:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9611:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9686:Adamts19	UTSW	18	58838021	missense	probably benign	0.00
R9697:Adamts19	UTSW	18	58968762	missense	probably damaging	0.99
R9747:Adamts19	UTSW	18	58890415	missense	possibly damaging	0.69
Z1177:Adamts19	UTSW	18	58838075	missense	probably damaging	1.00
Z1177:Adamts19	UTSW	18	58890374	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- GAAGTCGTGTTTCCTGCACTC -3'
(R):5'- TGTCCCGGTGTAAAAGCAGG -3'

Sequencing Primer
(F):5'- AATCTGAGCCCTGGTTCGG -3'
(R):5'- TGTAAAAGCAGGAGGCATCTGGCAGC -3'

Posted On

2020-07-28