Incidental Mutation 'R8298:Dyrk3'
ID639052
Institutional Source Beutler Lab
Gene Symbol Dyrk3
Ensembl Gene ENSMUSG00000016526
Gene Namedual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R8298 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location131127455-131138340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 131129375 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 354 (D354N)
Ref Sequence ENSEMBL: ENSMUSP00000016670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016670] [ENSMUST00000189756]
Predicted Effect probably damaging
Transcript: ENSMUST00000016670
AA Change: D354N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000016670
Gene: ENSMUSG00000016526
AA Change: D354N

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
S_TKc 208 521 2.45e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189756
SMART Domains Protein: ENSMUSP00000140050
Gene: ENSMUSG00000016526

DomainStartEndE-ValueType
PDB:4AZF|A 101 152 3e-18 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the DYRK family of dual-specificity protein kinases that catalyze autophosphorylation on serine/threonine and tyrosine residues. The members of this family share structural similarity, however, differ in their substrate specificity, suggesting their involvement in different cellular functions. The encoded protein has been shown to autophosphorylate on tyrosine residue and catalyze phosphorylation of histones H3 and H2B in vitro. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased erythropoiesis in response to chemically-induced anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P16Rik A C 4: 104,948,831 E369D probably damaging Het
4930453N24Rik A G 16: 64,766,332 L343P probably benign Het
Aak1 T A 6: 86,925,079 F77I possibly damaging Het
Abca3 T C 17: 24,385,401 L582P probably damaging Het
Acat1 A T 9: 53,594,424 S136R probably damaging Het
Adamts2 T C 11: 50,777,131 F507L possibly damaging Het
Adcy3 G A 12: 4,206,482 A763T probably damaging Het
Adgrv1 A T 13: 81,385,914 C5849* probably null Het
Adrb2 A T 18: 62,178,682 N357K probably benign Het
Ak9 A G 10: 41,389,058 E404G Het
Akap13 T C 7: 75,747,804 L2576P probably damaging Het
Armcx5 AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA X: 135,745,704 probably benign Het
Arv1 A G 8: 124,728,372 Y108C probably damaging Het
Casp8ap2 T A 4: 32,640,429 H494Q probably benign Het
Ccdc88b A G 19: 6,850,281 L951P probably damaging Het
D830039M14Rik A T 10: 61,475,583 M160K noncoding transcript Het
Dbf4 A G 5: 8,412,115 probably benign Het
Dennd4a A G 9: 64,906,875 D1458G probably benign Het
Dock10 T C 1: 80,536,937 K1422R probably benign Het
Epha3 T A 16: 63,566,598 I892F probably benign Het
Evi5 G A 5: 107,816,865 S317L possibly damaging Het
Evl C T 12: 108,652,973 P76S probably benign Het
Gm1000 T C 12: 104,476,177 probably benign Het
Gm1979 T C 5: 26,001,150 N190S probably damaging Het
Gm3633 T C 14: 42,640,718 E72G Het
Gm5414 T C 15: 101,624,170 Y506C unknown Het
Gm572 T A 4: 148,658,093 H96Q possibly damaging Het
Gml T C 15: 74,813,692 E148G probably damaging Het
Got1l1 T C 8: 27,198,558 D255G probably benign Het
Hydin A G 8: 110,600,383 N4785D probably damaging Het
Kcnk12 A T 17: 87,797,285 F57Y probably damaging Het
Klhdc9 C A 1: 171,358,861 G336C probably damaging Het
Kprp T C 3: 92,825,300 T148A probably damaging Het
Lama3 G A 18: 12,525,853 R2022Q probably benign Het
Lelp1 A T 3: 92,135,620 S41T unknown Het
Lnx2 A T 5: 147,024,517 M535K probably benign Het
Mmp9 T A 2: 164,950,359 F294L probably null Het
Myo7a T C 7: 98,098,334 Y97C probably damaging Het
Nav2 T C 7: 49,554,261 probably null Het
Ndufaf3 T C 9: 108,566,921 T3A probably benign Het
Nrxn1 A G 17: 90,704,169 I344T probably damaging Het
Olfr1020 T C 2: 85,850,189 S246P probably damaging Het
Olfr1137 A T 2: 87,711,032 S291R probably damaging Het
Olfr3 T C 2: 36,813,026 E22G probably benign Het
Pccb T C 9: 100,985,832 D384G probably damaging Het
Plekhg3 C T 12: 76,577,078 H1032Y probably damaging Het
Ppfia3 A G 7: 45,360,194 S125P probably damaging Het
Prl7a2 T C 13: 27,661,011 M131V probably benign Het
Prmt3 A G 7: 49,857,438 T517A probably benign Het
Prpf4b A G 13: 34,888,183 H491R unknown Het
Rhot1 T A 11: 80,246,676 C335S probably benign Het
Robo1 C T 16: 72,972,132 probably benign Het
Samd3 A T 10: 26,245,570 D195V probably damaging Het
Sh3gl2 T A 4: 85,379,410 D208E possibly damaging Het
Spta1 A T 1: 174,247,387 D2393V probably damaging Het
Tgs1 T C 4: 3,605,840 L785P probably damaging Het
Tmem25 C T 9: 44,798,819 probably benign Het
Trappc10 A G 10: 78,202,919 Y780H probably damaging Het
Ttn C A 2: 76,727,167 W29861L probably damaging Het
Usp1 T A 4: 98,930,899 D199E probably damaging Het
Vmn2r40 A G 7: 8,908,149 I715T Het
Zfp169 G A 13: 48,498,377 Q68* probably null Het
Zfp418 T A 7: 7,182,815 Y592* probably null Het
Zfp712 A G 13: 67,040,912 V517A probably benign Het
Zfp934 A T 13: 62,518,481 H146Q Het
Zgrf1 T C 3: 127,615,229 S1662P probably damaging Het
Other mutations in Dyrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Dyrk3 APN 1 131136337 missense possibly damaging 0.71
IGL00910:Dyrk3 APN 1 131136336 missense possibly damaging 0.92
IGL02436:Dyrk3 APN 1 131128865 missense probably benign 0.00
IGL03057:Dyrk3 APN 1 131129078 missense probably benign 0.01
PIT4576001:Dyrk3 UTSW 1 131130181 missense probably damaging 0.98
R0116:Dyrk3 UTSW 1 131129839 missense probably damaging 1.00
R0361:Dyrk3 UTSW 1 131130032 missense probably benign 0.00
R0457:Dyrk3 UTSW 1 131136357 missense possibly damaging 0.94
R0529:Dyrk3 UTSW 1 131130121 missense probably benign 0.00
R0724:Dyrk3 UTSW 1 131130140 missense probably benign 0.00
R1116:Dyrk3 UTSW 1 131129182 missense probably damaging 1.00
R2999:Dyrk3 UTSW 1 131129446 missense probably damaging 1.00
R3423:Dyrk3 UTSW 1 131129482 missense probably damaging 1.00
R4591:Dyrk3 UTSW 1 131130158 missense probably damaging 1.00
R5358:Dyrk3 UTSW 1 131129695 missense probably damaging 1.00
R5608:Dyrk3 UTSW 1 131128715 missense probably benign
R6767:Dyrk3 UTSW 1 131129590 missense probably damaging 0.99
R7072:Dyrk3 UTSW 1 131129728 missense probably damaging 1.00
R7744:Dyrk3 UTSW 1 131129806 missense probably damaging 1.00
R7775:Dyrk3 UTSW 1 131129627 missense possibly damaging 0.84
R7909:Dyrk3 UTSW 1 131129587 missense probably damaging 1.00
R7961:Dyrk3 UTSW 1 131136258 critical splice donor site probably null
R8009:Dyrk3 UTSW 1 131136258 critical splice donor site probably null
Z1088:Dyrk3 UTSW 1 131129233 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAACTCTATCATGCAGGCC -3'
(R):5'- CTGCTAAGCATAGACCTGTATGAGC -3'

Sequencing Primer
(F):5'- GGCCAACTGGTCTCCTTCG -3'
(R):5'- GGACGCTCTGCACAAAAA -3'
Posted On2020-07-28