Incidental Mutation 'R8298:Kprp'
ID639061
Institutional Source Beutler Lab
Gene Symbol Kprp
Ensembl Gene ENSMUSG00000059832
Gene Namekeratinocyte expressed, proline-rich
Synonyms1110001M24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R8298 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location92823074-92827247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92825300 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 148 (T148A)
Ref Sequence ENSEMBL: ENSMUSP00000072200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072363]
Predicted Effect probably damaging
Transcript: ENSMUST00000072363
AA Change: T148A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000072200
Gene: ENSMUSG00000059832
AA Change: T148A

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 177 199 N/A INTRINSIC
low complexity region 292 302 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 380 397 N/A INTRINSIC
low complexity region 446 502 N/A INTRINSIC
low complexity region 515 534 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a proline-rich skin protein possibly involved in keratinocyte differentiation. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P16Rik A C 4: 104,948,831 E369D probably damaging Het
4930453N24Rik A G 16: 64,766,332 L343P probably benign Het
Aak1 T A 6: 86,925,079 F77I possibly damaging Het
Abca3 T C 17: 24,385,401 L582P probably damaging Het
Acat1 A T 9: 53,594,424 S136R probably damaging Het
Adamts2 T C 11: 50,777,131 F507L possibly damaging Het
Adcy3 G A 12: 4,206,482 A763T probably damaging Het
Adgrv1 A T 13: 81,385,914 C5849* probably null Het
Adrb2 A T 18: 62,178,682 N357K probably benign Het
Ak9 A G 10: 41,389,058 E404G Het
Akap13 T C 7: 75,747,804 L2576P probably damaging Het
Armcx5 AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA X: 135,745,704 probably benign Het
Arv1 A G 8: 124,728,372 Y108C probably damaging Het
Casp8ap2 T A 4: 32,640,429 H494Q probably benign Het
Ccdc88b A G 19: 6,850,281 L951P probably damaging Het
D830039M14Rik A T 10: 61,475,583 M160K noncoding transcript Het
Dbf4 A G 5: 8,412,115 probably benign Het
Dennd4a A G 9: 64,906,875 D1458G probably benign Het
Dock10 T C 1: 80,536,937 K1422R probably benign Het
Dyrk3 C T 1: 131,129,375 D354N probably damaging Het
Epha3 T A 16: 63,566,598 I892F probably benign Het
Evi5 G A 5: 107,816,865 S317L possibly damaging Het
Evl C T 12: 108,652,973 P76S probably benign Het
Gm1000 T C 12: 104,476,177 probably benign Het
Gm1979 T C 5: 26,001,150 N190S probably damaging Het
Gm3633 T C 14: 42,640,718 E72G Het
Gm5414 T C 15: 101,624,170 Y506C unknown Het
Gm572 T A 4: 148,658,093 H96Q possibly damaging Het
Gml T C 15: 74,813,692 E148G probably damaging Het
Got1l1 T C 8: 27,198,558 D255G probably benign Het
Hydin A G 8: 110,600,383 N4785D probably damaging Het
Kcnk12 A T 17: 87,797,285 F57Y probably damaging Het
Klhdc9 C A 1: 171,358,861 G336C probably damaging Het
Lama3 G A 18: 12,525,853 R2022Q probably benign Het
Lelp1 A T 3: 92,135,620 S41T unknown Het
Lnx2 A T 5: 147,024,517 M535K probably benign Het
Mmp9 T A 2: 164,950,359 F294L probably null Het
Myo7a T C 7: 98,098,334 Y97C probably damaging Het
Nav2 T C 7: 49,554,261 probably null Het
Ndufaf3 T C 9: 108,566,921 T3A probably benign Het
Nrxn1 A G 17: 90,704,169 I344T probably damaging Het
Olfr1020 T C 2: 85,850,189 S246P probably damaging Het
Olfr1137 A T 2: 87,711,032 S291R probably damaging Het
Olfr3 T C 2: 36,813,026 E22G probably benign Het
Pccb T C 9: 100,985,832 D384G probably damaging Het
Plekhg3 C T 12: 76,577,078 H1032Y probably damaging Het
Ppfia3 A G 7: 45,360,194 S125P probably damaging Het
Prl7a2 T C 13: 27,661,011 M131V probably benign Het
Prmt3 A G 7: 49,857,438 T517A probably benign Het
Prpf4b A G 13: 34,888,183 H491R unknown Het
Rhot1 T A 11: 80,246,676 C335S probably benign Het
Robo1 C T 16: 72,972,132 probably benign Het
Samd3 A T 10: 26,245,570 D195V probably damaging Het
Sh3gl2 T A 4: 85,379,410 D208E possibly damaging Het
Spta1 A T 1: 174,247,387 D2393V probably damaging Het
Tgs1 T C 4: 3,605,840 L785P probably damaging Het
Tmem25 C T 9: 44,798,819 probably benign Het
Trappc10 A G 10: 78,202,919 Y780H probably damaging Het
Ttn C A 2: 76,727,167 W29861L probably damaging Het
Usp1 T A 4: 98,930,899 D199E probably damaging Het
Vmn2r40 A G 7: 8,908,149 I715T Het
Zfp169 G A 13: 48,498,377 Q68* probably null Het
Zfp418 T A 7: 7,182,815 Y592* probably null Het
Zfp712 A G 13: 67,040,912 V517A probably benign Het
Zfp934 A T 13: 62,518,481 H146Q Het
Zgrf1 T C 3: 127,615,229 S1662P probably damaging Het
Other mutations in Kprp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00727:Kprp APN 3 92824427 missense unknown
IGL01566:Kprp APN 3 92823964 missense probably benign 0.11
R0062:Kprp UTSW 3 92824682 missense probably damaging 1.00
R0062:Kprp UTSW 3 92824682 missense probably damaging 1.00
R0244:Kprp UTSW 3 92825411 missense probably benign 0.06
R0364:Kprp UTSW 3 92824335 nonsense probably null
R0414:Kprp UTSW 3 92825713 missense probably damaging 1.00
R0511:Kprp UTSW 3 92824723 missense probably damaging 1.00
R0555:Kprp UTSW 3 92824357 missense unknown
R0800:Kprp UTSW 3 92825035 missense unknown
R1356:Kprp UTSW 3 92825602 missense probably damaging 1.00
R1550:Kprp UTSW 3 92824726 missense probably damaging 0.96
R1571:Kprp UTSW 3 92825382 nonsense probably null
R1618:Kprp UTSW 3 92825476 missense probably damaging 0.99
R2424:Kprp UTSW 3 92825605 missense probably damaging 1.00
R2680:Kprp UTSW 3 92824463 missense unknown
R3605:Kprp UTSW 3 92824281 missense unknown
R3606:Kprp UTSW 3 92824281 missense unknown
R3607:Kprp UTSW 3 92824281 missense unknown
R3755:Kprp UTSW 3 92825039 missense unknown
R4116:Kprp UTSW 3 92823968 missense probably damaging 1.00
R4204:Kprp UTSW 3 92824739 missense probably damaging 0.99
R4320:Kprp UTSW 3 92824856 missense probably damaging 1.00
R4321:Kprp UTSW 3 92824856 missense probably damaging 1.00
R4323:Kprp UTSW 3 92824856 missense probably damaging 1.00
R4575:Kprp UTSW 3 92823964 missense probably benign 0.11
R4864:Kprp UTSW 3 92824522 missense unknown
R5133:Kprp UTSW 3 92824522 missense unknown
R5583:Kprp UTSW 3 92824336 missense unknown
R5902:Kprp UTSW 3 92824528 missense unknown
R5990:Kprp UTSW 3 92824774 missense probably damaging 1.00
R6198:Kprp UTSW 3 92824687 missense probably damaging 1.00
R6633:Kprp UTSW 3 92825293 missense probably damaging 1.00
R7025:Kprp UTSW 3 92825197 missense probably benign 0.03
R7269:Kprp UTSW 3 92823871 missense probably damaging 0.96
R7951:Kprp UTSW 3 92824330 missense unknown
Z1088:Kprp UTSW 3 92825057 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGATTGAGGAGTGCAGCTACC -3'
(R):5'- CAGGCTCCATGTAAGACCAC -3'

Sequencing Primer
(F):5'- CGTAGGAGCCCTGATACTGGTAC -3'
(R):5'- GTGCCAGTCAAAGACTACCCAGG -3'
Posted On2020-07-28