Mutagenetix > Incidental Mutation

Incidental Mutation 'R0697:A1cf'

63908

Institutional Source

Beutler Lab

Gene Symbol

A1cf

Ensembl Gene

ENSMUSG00000052595

Gene Name

APOBEC1 complementation factor

Synonyms

apobec-1 complementation factor, ACF, 1810073H04Rik

MMRRC Submission

038881-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R0697 (G1)

Quality Score

100

Status

Not validated

Chromosome

Chromosomal Location

31868764-31948573 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 31911167 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 99 (A99E)

Ref Sequence

ENSEMBL: ENSMUSP00000153465 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075838] [ENSMUST00000224304] [ENSMUST00000224400] [ENSMUST00000224564]

AlphaFold

Q5YD48

Predicted Effect

probably damaging
Transcript: ENSMUST00000075838
AA Change: A99E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000075235
Gene: ENSMUSG00000052595
AA Change: A99E

Domain	Start	End	E-Value	Type
RRM	57	130	2.13e-18	SMART
RRM	137	214	1.59e-8	SMART
RRM	232	299	1.36e-16	SMART
low complexity region	386	411	N/A	INTRINSIC
Pfam:DND1_DSRM	445	523	1.6e-30	PFAM
low complexity region	526	542	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000224304
AA Change: A99E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000224400
AA Change: A15E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000224564
AA Change: A99E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224809

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225165

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian apolipoprotein B mRNA undergoes site-specific C to U deamination, which is mediated by a multi-component enzyme complex containing a minimal core composed of APOBEC-1 and a complementation factor encoded by this gene. The gene product has three non-identical RNA recognition motifs and belongs to the hnRNP R family of RNA-binding proteins. It has been proposed that this complementation factor functions as an RNA-binding subunit and docks APOBEC-1 to deaminate the upstream cytidine. Studies suggest that the protein may also be involved in other RNA editing or RNA processing events. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Embryos homozygous for a targeted deletion of this gene are detectable only until the blastocyst stage (E3.5) and isolated mutant blastocysts fail to proliferate in vitro. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aig1	T	C	10: 13,829,325	N72S	probably benign	Het
Atad2	T	C	15: 58,105,543	I857M	possibly damaging	Het
Ceacam15	A	C	7: 16,673,520	L24*	probably null	Het
Cpsf2	A	G	12: 101,983,184	H53R	probably benign	Het
Crh	C	A	3: 19,694,077	G134C	probably damaging	Het
Cyp2g1	A	T	7: 26,814,727	K253*	probably null	Het
Dna2	T	C	10: 62,949,341	V79A	probably benign	Het
Dsc2	A	G	18: 20,041,452	V549A	probably damaging	Het
Etl4	G	T	2: 20,743,861	V135F	probably damaging	Het
Frk	A	G	10: 34,607,837	H398R	probably benign	Het
Gfra1	A	C	19: 58,270,123	S271A	probably benign	Het
Htr1b	T	C	9: 81,631,463	I364V	possibly damaging	Het
Kcnh5	A	T	12: 74,976,531	C588S	possibly damaging	Het
Kif13a	G	A	13: 46,848,337	T70I	probably benign	Het
Klra6	T	C	6: 130,016,724	I195V	probably benign	Het
Nras	T	C	3: 103,060,300	Y71H	possibly damaging	Het
Sirt5	T	C	13: 43,385,576	F274L	probably damaging	Het
Synj1	T	C	16: 90,960,615	T882A	probably benign	Het
Vmn1r84	A	T	7: 12,362,763	M1K	probably null	Het
Zfhx4	A	T	3: 5,401,733	E2317V	probably damaging	Het
Zfp345	A	T	2: 150,472,909	I236K	probably benign	Het

Other mutations in A1cf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:A1cf	APN	19	31920951	missense	possibly damaging	0.90
IGL01411:A1cf	APN	19	31911229	missense	possibly damaging	0.94
IGL01445:A1cf	APN	19	31945798	missense	probably benign	0.32
IGL02165:A1cf	APN	19	31927186	missense	possibly damaging	0.92
IGL02543:A1cf	APN	19	31918095	missense	probably damaging	0.97
IGL02651:A1cf	APN	19	31932506	missense	probably benign	0.25
IGL02904:A1cf	APN	19	31934806	missense	probably damaging	1.00
Haywire	UTSW	19	31918124	critical splice donor site	probably null
R0281:A1cf	UTSW	19	31945814	missense	probably benign	0.09
R0349:A1cf	UTSW	19	31932662	missense	possibly damaging	0.62
R0662:A1cf	UTSW	19	31920938	missense	probably benign	0.00
R1055:A1cf	UTSW	19	31932519	missense	probably benign	0.05
R1125:A1cf	UTSW	19	31920978	missense	probably benign	0.00
R1448:A1cf	UTSW	19	31908796	missense	possibly damaging	0.88
R1554:A1cf	UTSW	19	31908902	missense	possibly damaging	0.66
R1616:A1cf	UTSW	19	31934775	missense	probably damaging	0.98
R1660:A1cf	UTSW	19	31893107	nonsense	probably null
R1719:A1cf	UTSW	19	31927126	missense	probably damaging	1.00
R2338:A1cf	UTSW	19	31932545	missense	probably benign
R2435:A1cf	UTSW	19	31920894	missense	probably benign	0.02
R2890:A1cf	UTSW	19	31918017	missense	probably benign	0.05
R3688:A1cf	UTSW	19	31911169	missense	probably damaging	1.00
R4007:A1cf	UTSW	19	31918124	critical splice donor site	probably null
R4208:A1cf	UTSW	19	31932660	missense	probably benign	0.00
R4448:A1cf	UTSW	19	31945862	missense	probably benign
R5072:A1cf	UTSW	19	31917985	missense	probably benign	0.18
R5491:A1cf	UTSW	19	31918062	missense	possibly damaging	0.57
R5636:A1cf	UTSW	19	31944982	nonsense	probably null
R5932:A1cf	UTSW	19	31893118	missense	possibly damaging	0.68
R7066:A1cf	UTSW	19	31927114	missense	probably damaging	0.99
R7211:A1cf	UTSW	19	31927141	missense	probably benign	0.23
R7413:A1cf	UTSW	19	31918124	critical splice donor site	probably null
R7545:A1cf	UTSW	19	31934790	missense	possibly damaging	0.80
R8020:A1cf	UTSW	19	31893194	missense	probably benign	0.01
R8344:A1cf	UTSW	19	31911119	missense	possibly damaging	0.77
R8497:A1cf	UTSW	19	31945850	missense	probably benign
R8989:A1cf	UTSW	19	31927156	missense	possibly damaging	0.56
R9327:A1cf	UTSW	19	31918099	missense	probably benign	0.12
R9436:A1cf	UTSW	19	31932575	missense	probably benign
Z1176:A1cf	UTSW	19	31918017	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- CATGGATACAAATGCCAAACATGGCAG -3'
(R):5'- TCAAGTAGCATTCTCTCCGCACAATC -3'

Sequencing Primer
(F):5'- tgtttctgtgtgtgtgtgtttc -3'
(R):5'- ACCAGACCGTTTTTAACGAAG -3'

Posted On

2013-07-30