Incidental Mutation 'R8298:Dennd4a'
ID 639085
Institutional Source Beutler Lab
Gene Symbol Dennd4a
Ensembl Gene ENSMUSG00000053641
Gene Name DENN domain containing 4A
Synonyms F730015K02Rik
MMRRC Submission 067786-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.489) question?
Stock # R8298 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 64718622-64826949 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 64814157 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1458 (D1458G)
Ref Sequence ENSEMBL: ENSMUSP00000037915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038890]
AlphaFold E9Q8V6
Predicted Effect probably benign
Transcript: ENSMUST00000038890
AA Change: D1458G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000037915
Gene: ENSMUSG00000053641
AA Change: D1458G

DomainStartEndE-ValueType
internal_repeat_1 45 93 3.26e-5 PROSPERO
uDENN 169 276 1.71e-28 SMART
DENN 309 493 2.4e-73 SMART
dDENN 559 633 4.15e-27 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1176 1191 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1402 1417 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN domain-containing protein that may function as a guanine nucleotide exchange factor that specifically activates ras-related protein Rab-10. This protein also contains a interferon stimulated response element-binding domain and may be involved in regulating the v-myc avian myelocytomatosis viral (MYC) oncogene. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 8. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,586,695 (GRCm39) L343P probably benign Het
Aak1 T A 6: 86,902,061 (GRCm39) F77I possibly damaging Het
Abca3 T C 17: 24,604,375 (GRCm39) L582P probably damaging Het
Acat1 A T 9: 53,505,724 (GRCm39) S136R probably damaging Het
Adamts2 T C 11: 50,667,958 (GRCm39) F507L possibly damaging Het
Adcy3 G A 12: 4,256,482 (GRCm39) A763T probably damaging Het
Adgrv1 A T 13: 81,534,033 (GRCm39) C5849* probably null Het
Adrb2 A T 18: 62,311,753 (GRCm39) N357K probably benign Het
Ak9 A G 10: 41,265,054 (GRCm39) E404G Het
Akap13 T C 7: 75,397,552 (GRCm39) L2576P probably damaging Het
Armcx5 AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA X: 134,646,453 (GRCm39) probably benign Het
Arv1 A G 8: 125,455,111 (GRCm39) Y108C probably damaging Het
Casp8ap2 T A 4: 32,640,429 (GRCm39) H494Q probably benign Het
Ccdc88b A G 19: 6,827,649 (GRCm39) L951P probably damaging Het
D830039M14Rik A T 10: 61,311,362 (GRCm39) M160K noncoding transcript Het
Dbf4 A G 5: 8,462,115 (GRCm39) probably benign Het
Dock10 T C 1: 80,514,654 (GRCm39) K1422R probably benign Het
Dyrk3 C T 1: 131,057,112 (GRCm39) D354N probably damaging Het
Epha3 T A 16: 63,386,961 (GRCm39) I892F probably benign Het
Evi5 G A 5: 107,964,731 (GRCm39) S317L possibly damaging Het
Evl C T 12: 108,619,232 (GRCm39) P76S probably benign Het
Fyb2 A C 4: 104,806,028 (GRCm39) E369D probably damaging Het
Gm10000 T C 12: 104,442,436 (GRCm39) probably benign Het
Gm1979 T C 5: 26,206,148 (GRCm39) N190S probably damaging Het
Gm3633 T C 14: 42,462,675 (GRCm39) E72G Het
Gm5414 T C 15: 101,532,605 (GRCm39) Y506C unknown Het
Gm572 T A 4: 148,742,550 (GRCm39) H96Q possibly damaging Het
Gml T C 15: 74,685,541 (GRCm39) E148G probably damaging Het
Got1l1 T C 8: 27,688,586 (GRCm39) D255G probably benign Het
Hydin A G 8: 111,327,015 (GRCm39) N4785D probably damaging Het
Kcnk12 A T 17: 88,104,713 (GRCm39) F57Y probably damaging Het
Klhdc9 C A 1: 171,186,429 (GRCm39) G336C probably damaging Het
Kprp T C 3: 92,732,607 (GRCm39) T148A probably damaging Het
Lama3 G A 18: 12,658,910 (GRCm39) R2022Q probably benign Het
Lelp1 A T 3: 92,042,927 (GRCm39) S41T unknown Het
Lnx2 A T 5: 146,961,327 (GRCm39) M535K probably benign Het
Mmp9 T A 2: 164,792,279 (GRCm39) F294L probably null Het
Myo7a T C 7: 97,747,541 (GRCm39) Y97C probably damaging Het
Nav2 T C 7: 49,204,009 (GRCm39) probably null Het
Ndufaf3 T C 9: 108,444,120 (GRCm39) T3A probably benign Het
Nrxn1 A G 17: 91,011,597 (GRCm39) I344T probably damaging Het
Or1j1 T C 2: 36,703,038 (GRCm39) E22G probably benign Het
Or5ap2 T C 2: 85,680,533 (GRCm39) S246P probably damaging Het
Or5w14 A T 2: 87,541,376 (GRCm39) S291R probably damaging Het
Pccb T C 9: 100,867,885 (GRCm39) D384G probably damaging Het
Plekhg3 C T 12: 76,623,852 (GRCm39) H1032Y probably damaging Het
Ppfia3 A G 7: 45,009,618 (GRCm39) S125P probably damaging Het
Prl7a2 T C 13: 27,844,994 (GRCm39) M131V probably benign Het
Prmt3 A G 7: 49,507,186 (GRCm39) T517A probably benign Het
Prpf4b A G 13: 35,072,166 (GRCm39) H491R unknown Het
Rhot1 T A 11: 80,137,502 (GRCm39) C335S probably benign Het
Robo1 C T 16: 72,769,020 (GRCm39) probably benign Het
Samd3 A T 10: 26,121,468 (GRCm39) D195V probably damaging Het
Sh3gl2 T A 4: 85,297,647 (GRCm39) D208E possibly damaging Het
Spta1 A T 1: 174,074,953 (GRCm39) D2393V probably damaging Het
Tgs1 T C 4: 3,605,840 (GRCm39) L785P probably damaging Het
Tmem25 C T 9: 44,710,116 (GRCm39) probably benign Het
Trappc10 A G 10: 78,038,753 (GRCm39) Y780H probably damaging Het
Ttn C A 2: 76,557,511 (GRCm39) W29861L probably damaging Het
Usp1 T A 4: 98,819,136 (GRCm39) D199E probably damaging Het
Vmn2r40 A G 7: 8,911,148 (GRCm39) I715T Het
Zfp169 G A 13: 48,651,853 (GRCm39) Q68* probably null Het
Zfp418 T A 7: 7,185,814 (GRCm39) Y592* probably null Het
Zfp712 A G 13: 67,188,976 (GRCm39) V517A probably benign Het
Zfp934 A T 13: 62,666,295 (GRCm39) H146Q Het
Zgrf1 T C 3: 127,408,878 (GRCm39) S1662P probably damaging Het
Other mutations in Dennd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dennd4a APN 9 64,819,044 (GRCm39) missense probably damaging 1.00
IGL01610:Dennd4a APN 9 64,814,166 (GRCm39) missense probably damaging 0.99
IGL01788:Dennd4a APN 9 64,749,903 (GRCm39) missense probably benign 0.00
IGL01827:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL01828:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL01829:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL01979:Dennd4a APN 9 64,801,691 (GRCm39) missense probably benign 0.00
IGL02100:Dennd4a APN 9 64,816,988 (GRCm39) splice site probably benign
IGL02339:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL02341:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL02584:Dennd4a APN 9 64,758,580 (GRCm39) missense probably damaging 1.00
IGL02607:Dennd4a APN 9 64,769,609 (GRCm39) missense probably damaging 0.99
IGL02654:Dennd4a APN 9 64,817,473 (GRCm39) splice site probably benign
IGL02701:Dennd4a APN 9 64,804,635 (GRCm39) missense possibly damaging 0.50
IGL03051:Dennd4a APN 9 64,769,696 (GRCm39) missense probably damaging 1.00
IGL03257:Dennd4a APN 9 64,779,156 (GRCm39) missense possibly damaging 0.93
IGL03346:Dennd4a APN 9 64,795,808 (GRCm39) missense possibly damaging 0.47
IGL03349:Dennd4a APN 9 64,796,256 (GRCm39) missense probably damaging 1.00
IGL03398:Dennd4a APN 9 64,779,164 (GRCm39) missense probably benign 0.32
R0010:Dennd4a UTSW 9 64,803,997 (GRCm39) missense probably benign 0.00
R0010:Dennd4a UTSW 9 64,803,997 (GRCm39) missense probably benign 0.00
R0129:Dennd4a UTSW 9 64,800,576 (GRCm39) missense probably damaging 1.00
R0220:Dennd4a UTSW 9 64,759,727 (GRCm39) missense probably damaging 1.00
R0396:Dennd4a UTSW 9 64,769,673 (GRCm39) missense probably damaging 1.00
R0881:Dennd4a UTSW 9 64,758,665 (GRCm39) critical splice donor site probably null
R1225:Dennd4a UTSW 9 64,818,957 (GRCm39) missense probably benign 0.03
R1311:Dennd4a UTSW 9 64,817,286 (GRCm39) missense probably benign 0.34
R1448:Dennd4a UTSW 9 64,813,327 (GRCm39) missense possibly damaging 0.95
R1450:Dennd4a UTSW 9 64,818,947 (GRCm39) missense probably benign 0.03
R1630:Dennd4a UTSW 9 64,779,164 (GRCm39) missense probably benign 0.32
R1709:Dennd4a UTSW 9 64,796,887 (GRCm39) missense possibly damaging 0.92
R1824:Dennd4a UTSW 9 64,766,640 (GRCm39) critical splice donor site probably null
R1851:Dennd4a UTSW 9 64,769,312 (GRCm39) missense probably damaging 1.00
R1870:Dennd4a UTSW 9 64,804,516 (GRCm39) missense probably benign 0.00
R1900:Dennd4a UTSW 9 64,804,618 (GRCm39) missense probably damaging 0.99
R1911:Dennd4a UTSW 9 64,796,368 (GRCm39) missense probably damaging 1.00
R1938:Dennd4a UTSW 9 64,749,772 (GRCm39) missense probably damaging 1.00
R1954:Dennd4a UTSW 9 64,759,749 (GRCm39) missense probably benign 0.02
R1955:Dennd4a UTSW 9 64,759,749 (GRCm39) missense probably benign 0.02
R2049:Dennd4a UTSW 9 64,796,887 (GRCm39) missense possibly damaging 0.92
R2129:Dennd4a UTSW 9 64,813,256 (GRCm39) splice site probably null
R2138:Dennd4a UTSW 9 64,796,619 (GRCm39) missense probably damaging 1.00
R2929:Dennd4a UTSW 9 64,759,699 (GRCm39) missense possibly damaging 0.85
R3083:Dennd4a UTSW 9 64,813,363 (GRCm39) missense probably benign 0.03
R3108:Dennd4a UTSW 9 64,819,669 (GRCm39) missense probably benign 0.23
R3176:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3177:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3276:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3277:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3890:Dennd4a UTSW 9 64,779,310 (GRCm39) missense probably damaging 1.00
R3953:Dennd4a UTSW 9 64,759,857 (GRCm39) missense probably damaging 1.00
R3963:Dennd4a UTSW 9 64,769,613 (GRCm39) missense probably damaging 1.00
R4059:Dennd4a UTSW 9 64,819,174 (GRCm39) missense possibly damaging 0.92
R4499:Dennd4a UTSW 9 64,817,405 (GRCm39) missense possibly damaging 0.78
R4500:Dennd4a UTSW 9 64,817,405 (GRCm39) missense possibly damaging 0.78
R4501:Dennd4a UTSW 9 64,817,405 (GRCm39) missense possibly damaging 0.78
R4671:Dennd4a UTSW 9 64,801,689 (GRCm39) missense probably benign
R4701:Dennd4a UTSW 9 64,804,639 (GRCm39) missense possibly damaging 0.91
R4821:Dennd4a UTSW 9 64,804,531 (GRCm39) missense possibly damaging 0.92
R4829:Dennd4a UTSW 9 64,796,338 (GRCm39) missense probably damaging 1.00
R4876:Dennd4a UTSW 9 64,803,872 (GRCm39) missense probably benign
R4881:Dennd4a UTSW 9 64,746,126 (GRCm39) missense possibly damaging 0.77
R4962:Dennd4a UTSW 9 64,813,285 (GRCm39) missense probably benign 0.00
R5225:Dennd4a UTSW 9 64,796,210 (GRCm39) missense possibly damaging 0.94
R5557:Dennd4a UTSW 9 64,811,509 (GRCm39) missense probably benign 0.07
R5649:Dennd4a UTSW 9 64,758,491 (GRCm39) splice site probably null
R5868:Dennd4a UTSW 9 64,804,011 (GRCm39) missense probably benign 0.02
R5876:Dennd4a UTSW 9 64,819,037 (GRCm39) missense probably damaging 1.00
R6052:Dennd4a UTSW 9 64,794,227 (GRCm39) missense probably damaging 1.00
R6411:Dennd4a UTSW 9 64,779,181 (GRCm39) missense probably benign 0.04
R6596:Dennd4a UTSW 9 64,759,702 (GRCm39) missense probably damaging 1.00
R6668:Dennd4a UTSW 9 64,794,247 (GRCm39) missense probably damaging 1.00
R6915:Dennd4a UTSW 9 64,759,771 (GRCm39) nonsense probably null
R7056:Dennd4a UTSW 9 64,814,205 (GRCm39) missense possibly damaging 0.89
R7107:Dennd4a UTSW 9 64,801,681 (GRCm39) missense possibly damaging 0.79
R7203:Dennd4a UTSW 9 64,803,756 (GRCm39) missense probably benign 0.05
R7238:Dennd4a UTSW 9 64,769,238 (GRCm39) missense probably damaging 1.00
R7373:Dennd4a UTSW 9 64,804,551 (GRCm39) missense probably benign 0.01
R7454:Dennd4a UTSW 9 64,759,852 (GRCm39) missense probably damaging 1.00
R7546:Dennd4a UTSW 9 64,780,326 (GRCm39) missense probably damaging 1.00
R7590:Dennd4a UTSW 9 64,795,869 (GRCm39) missense probably benign 0.01
R7662:Dennd4a UTSW 9 64,759,713 (GRCm39) missense probably damaging 1.00
R7782:Dennd4a UTSW 9 64,814,202 (GRCm39) missense probably damaging 0.98
R7909:Dennd4a UTSW 9 64,780,275 (GRCm39) critical splice acceptor site probably null
R7976:Dennd4a UTSW 9 64,759,794 (GRCm39) missense possibly damaging 0.95
R8026:Dennd4a UTSW 9 64,780,312 (GRCm39) missense probably damaging 1.00
R8034:Dennd4a UTSW 9 64,795,850 (GRCm39) missense probably benign 0.01
R8089:Dennd4a UTSW 9 64,756,457 (GRCm39) missense probably damaging 1.00
R8397:Dennd4a UTSW 9 64,796,391 (GRCm39) missense probably benign
R8425:Dennd4a UTSW 9 64,746,256 (GRCm39) missense probably damaging 1.00
R8495:Dennd4a UTSW 9 64,794,161 (GRCm39) missense probably damaging 1.00
R8855:Dennd4a UTSW 9 64,819,672 (GRCm39) missense probably benign
R9219:Dennd4a UTSW 9 64,796,376 (GRCm39) missense probably damaging 0.96
R9275:Dennd4a UTSW 9 64,749,906 (GRCm39) missense probably damaging 1.00
R9376:Dennd4a UTSW 9 64,819,974 (GRCm39) missense probably benign 0.00
R9485:Dennd4a UTSW 9 64,814,388 (GRCm39) nonsense probably null
R9672:Dennd4a UTSW 9 64,800,640 (GRCm39) missense probably benign
R9746:Dennd4a UTSW 9 64,801,793 (GRCm39) missense probably benign
X0026:Dennd4a UTSW 9 64,804,602 (GRCm39) missense possibly damaging 0.67
Z1088:Dennd4a UTSW 9 64,779,304 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTGTCATTTTGCACAGC -3'
(R):5'- CTGTTGATGAGCTGGACTTCAAG -3'

Sequencing Primer
(F):5'- CATGTGGCTGTATTTGCTCAGATC -3'
(R):5'- GCGGTATTTTAGGAAACAATACCC -3'
Posted On 2020-07-28