Incidental Mutation 'R0697:Gfra1'
ID 63909
Institutional Source Beutler Lab
Gene Symbol Gfra1
Ensembl Gene ENSMUSG00000025089
Gene Name glial cell line derived neurotrophic factor family receptor alpha 1
Synonyms GDNFR-alpha, GFR alpha-1
MMRRC Submission 038881-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0697 (G1)
Quality Score 156
Status Not validated
Chromosome 19
Chromosomal Location 58235604-58455909 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 58270123 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 271 (S271A)
Ref Sequence ENSEMBL: ENSMUSP00000130128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026076] [ENSMUST00000129100] [ENSMUST00000140141] [ENSMUST00000152507] [ENSMUST00000169850]
AlphaFold P97785
Predicted Effect probably benign
Transcript: ENSMUST00000026076
AA Change: S271A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026076
Gene: ENSMUSG00000025089
AA Change: S271A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 154 233 6.55e-24 SMART
GDNF 243 337 1.62e-28 SMART
low complexity region 362 370 N/A INTRINSIC
low complexity region 455 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129100
AA Change: S266A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117196
Gene: ENSMUSG00000025089
AA Change: S266A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 149 228 6.55e-24 SMART
GDNF 238 332 1.62e-28 SMART
low complexity region 357 365 N/A INTRINSIC
low complexity region 450 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140141
AA Change: S271A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123022
Gene: ENSMUSG00000025089
AA Change: S271A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 154 233 6.55e-24 SMART
GDNF 243 337 1.62e-28 SMART
low complexity region 362 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152507
AA Change: S271A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120333
Gene: ENSMUSG00000025089
AA Change: S271A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 154 233 6.55e-24 SMART
GDNF 243 337 1.62e-28 SMART
low complexity region 362 370 N/A INTRINSIC
low complexity region 455 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169850
AA Change: S271A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130128
Gene: ENSMUSG00000025089
AA Change: S271A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 154 233 6.55e-24 SMART
GDNF 243 337 1.62e-28 SMART
low complexity region 362 370 N/A INTRINSIC
low complexity region 455 465 N/A INTRINSIC
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that functions as the receptor for glial cell line derived neurotrophic factor (GDNF). The encoded protein undergoes proteolytic processing to generate a glycosylphosphatidylinositol-anchored cell surface coreceptor that forms a complex with the Ret tyrosine kinase in GDNF signaling pathway. Mice lacking the encoded protein exhibit deficits in the kidneys, the enteric nervous system, and spinal motor and sensory neurons similar mice deficient in GDNF or Ret. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted null mutations lack kidneys and enteric neurons resulting in neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C A 19: 31,911,167 A99E probably damaging Het
Aig1 T C 10: 13,829,325 N72S probably benign Het
Atad2 T C 15: 58,105,543 I857M possibly damaging Het
Ceacam15 A C 7: 16,673,520 L24* probably null Het
Cpsf2 A G 12: 101,983,184 H53R probably benign Het
Crh C A 3: 19,694,077 G134C probably damaging Het
Cyp2g1 A T 7: 26,814,727 K253* probably null Het
Dna2 T C 10: 62,949,341 V79A probably benign Het
Dsc2 A G 18: 20,041,452 V549A probably damaging Het
Etl4 G T 2: 20,743,861 V135F probably damaging Het
Frk A G 10: 34,607,837 H398R probably benign Het
Htr1b T C 9: 81,631,463 I364V possibly damaging Het
Kcnh5 A T 12: 74,976,531 C588S possibly damaging Het
Kif13a G A 13: 46,848,337 T70I probably benign Het
Klra6 T C 6: 130,016,724 I195V probably benign Het
Nras T C 3: 103,060,300 Y71H possibly damaging Het
Sirt5 T C 13: 43,385,576 F274L probably damaging Het
Synj1 T C 16: 90,960,615 T882A probably benign Het
Vmn1r84 A T 7: 12,362,763 M1K probably null Het
Zfhx4 A T 3: 5,401,733 E2317V probably damaging Het
Zfp345 A T 2: 150,472,909 I236K probably benign Het
Other mutations in Gfra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Gfra1 APN 19 58263905 splice site probably benign
IGL01633:Gfra1 APN 19 58267047 missense probably benign 0.41
IGL02675:Gfra1 APN 19 58453355 missense probably damaging 1.00
IGL02676:Gfra1 APN 19 58453355 missense probably damaging 1.00
IGL02677:Gfra1 APN 19 58453355 missense probably damaging 1.00
IGL02723:Gfra1 APN 19 58453251 missense probably benign 0.00
3-1:Gfra1 UTSW 19 58298567 intron probably benign
R0245:Gfra1 UTSW 19 58300554 missense possibly damaging 0.72
R0652:Gfra1 UTSW 19 58300554 missense possibly damaging 0.72
R0699:Gfra1 UTSW 19 58270123 missense probably benign
R1344:Gfra1 UTSW 19 58238417 missense possibly damaging 0.88
R1418:Gfra1 UTSW 19 58238417 missense possibly damaging 0.88
R1468:Gfra1 UTSW 19 58451975 missense probably benign 0.00
R1468:Gfra1 UTSW 19 58451975 missense probably benign 0.00
R2001:Gfra1 UTSW 19 58300275 missense probably damaging 1.00
R2866:Gfra1 UTSW 19 58239307 missense possibly damaging 0.93
R3416:Gfra1 UTSW 19 58267112 missense probably damaging 1.00
R4352:Gfra1 UTSW 19 58267024 missense probably benign 0.08
R4564:Gfra1 UTSW 19 58239250 splice site probably null
R4727:Gfra1 UTSW 19 58263954 missense probably damaging 0.96
R4755:Gfra1 UTSW 19 58453244 missense probably damaging 1.00
R4914:Gfra1 UTSW 19 58267090 missense probably damaging 1.00
R4915:Gfra1 UTSW 19 58267090 missense probably damaging 1.00
R4917:Gfra1 UTSW 19 58267090 missense probably damaging 1.00
R5813:Gfra1 UTSW 19 58239255 missense probably benign
R6225:Gfra1 UTSW 19 58238398 missense probably damaging 1.00
R7023:Gfra1 UTSW 19 58454332 missense probably damaging 1.00
R7485:Gfra1 UTSW 19 58300312 missense probably damaging 1.00
R7624:Gfra1 UTSW 19 58238446 missense probably benign
R7718:Gfra1 UTSW 19 58453457 missense possibly damaging 0.69
R9659:Gfra1 UTSW 19 58453220 missense probably damaging 1.00
R9788:Gfra1 UTSW 19 58453220 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGCTTCATAATTAGCCCAGCTT -3'
(R):5'- TGTTATGTTTGTCCGAAGACGCAGT -3'

Sequencing Primer
(F):5'- tccttctttccttccttccttc -3'
(R):5'- TGGGGTGTTTTCAGTATCCC -3'
Posted On 2013-07-30