Incidental Mutation 'R8298:Prl7a2'
ID639098
Institutional Source Beutler Lab
Gene Symbol Prl7a2
Ensembl Gene ENSMUSG00000046899
Gene Nameprolactin family 7, subfamily a, member 2
SynonymsPLP-F, Prlpf
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R8298 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location27658584-27668036 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27661011 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 131 (M131V)
Ref Sequence ENSEMBL: ENSMUSP00000006660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006660]
Predicted Effect probably benign
Transcript: ENSMUST00000006660
AA Change: M131V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000006660
Gene: ENSMUSG00000046899
AA Change: M131V

DomainStartEndE-ValueType
Pfam:Hormone_1 17 244 6.9e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P16Rik A C 4: 104,948,831 E369D probably damaging Het
4930453N24Rik A G 16: 64,766,332 L343P probably benign Het
Aak1 T A 6: 86,925,079 F77I possibly damaging Het
Abca3 T C 17: 24,385,401 L582P probably damaging Het
Acat1 A T 9: 53,594,424 S136R probably damaging Het
Adamts2 T C 11: 50,777,131 F507L possibly damaging Het
Adcy3 G A 12: 4,206,482 A763T probably damaging Het
Adgrv1 A T 13: 81,385,914 C5849* probably null Het
Adrb2 A T 18: 62,178,682 N357K probably benign Het
Ak9 A G 10: 41,389,058 E404G Het
Akap13 T C 7: 75,747,804 L2576P probably damaging Het
Armcx5 AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA X: 135,745,704 probably benign Het
Arv1 A G 8: 124,728,372 Y108C probably damaging Het
Casp8ap2 T A 4: 32,640,429 H494Q probably benign Het
Ccdc88b A G 19: 6,850,281 L951P probably damaging Het
D830039M14Rik A T 10: 61,475,583 M160K noncoding transcript Het
Dennd4a A G 9: 64,906,875 D1458G probably benign Het
Dock10 T C 1: 80,536,937 K1422R probably benign Het
Dyrk3 C T 1: 131,129,375 D354N probably damaging Het
Epha3 T A 16: 63,566,598 I892F probably benign Het
Evi5 G A 5: 107,816,865 S317L possibly damaging Het
Evl C T 12: 108,652,973 P76S probably benign Het
Gm1000 T C 12: 104,476,177 probably benign Het
Gm1979 T C 5: 26,001,150 N190S probably damaging Het
Gm3633 T C 14: 42,640,718 E72G Het
Gm5414 T C 15: 101,624,170 Y506C unknown Het
Gm572 T A 4: 148,658,093 H96Q possibly damaging Het
Gml T C 15: 74,813,692 E148G probably damaging Het
Got1l1 T C 8: 27,198,558 D255G probably benign Het
Hydin A G 8: 110,600,383 N4785D probably damaging Het
Kcnk12 A T 17: 87,797,285 F57Y probably damaging Het
Klhdc9 C A 1: 171,358,861 G336C probably damaging Het
Kprp T C 3: 92,825,300 T148A probably damaging Het
Lama3 G A 18: 12,525,853 R2022Q probably benign Het
Lelp1 A T 3: 92,135,620 S41T unknown Het
Lnx2 A T 5: 147,024,517 M535K probably benign Het
Mmp9 T A 2: 164,950,359 F294L probably null Het
Myo7a T C 7: 98,098,334 Y97C probably damaging Het
Nav2 T C 7: 49,554,261 probably null Het
Ndufaf3 T C 9: 108,566,921 T3A probably benign Het
Nrxn1 A G 17: 90,704,169 I344T probably damaging Het
Olfr1020 T C 2: 85,850,189 S246P probably damaging Het
Olfr1137 A T 2: 87,711,032 S291R probably damaging Het
Olfr3 T C 2: 36,813,026 E22G probably benign Het
Pccb T C 9: 100,985,832 D384G probably damaging Het
Plekhg3 C T 12: 76,577,078 H1032Y probably damaging Het
Ppfia3 A G 7: 45,360,194 S125P probably damaging Het
Prmt3 A G 7: 49,857,438 T517A probably benign Het
Prpf4b A G 13: 34,888,183 H491R unknown Het
Rhot1 T A 11: 80,246,676 C335S probably benign Het
Samd3 A T 10: 26,245,570 D195V probably damaging Het
Sh3gl2 T A 4: 85,379,410 D208E possibly damaging Het
Spta1 A T 1: 174,247,387 D2393V probably damaging Het
Tgs1 T C 4: 3,605,840 L785P probably damaging Het
Tmem25 C T 9: 44,798,819 probably benign Het
Trappc10 A G 10: 78,202,919 Y780H probably damaging Het
Ttn C A 2: 76,727,167 W29861L probably damaging Het
Usp1 T A 4: 98,930,899 D199E probably damaging Het
Vmn2r40 A G 7: 8,908,149 I715T Het
Zfp169 G A 13: 48,498,377 Q68* probably null Het
Zfp418 T A 7: 7,182,815 Y592* probably null Het
Zfp712 A G 13: 67,040,912 V517A probably benign Het
Zfp934 A T 13: 62,518,481 H146Q Het
Zgrf1 T C 3: 127,615,229 S1662P probably damaging Het
Other mutations in Prl7a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Prl7a2 APN 13 27659208 missense probably damaging 0.98
IGL02424:Prl7a2 APN 13 27667970 missense probably null 0.08
IGL02734:Prl7a2 APN 13 27659207 missense probably benign 0.38
IGL02823:Prl7a2 APN 13 27662751 missense possibly damaging 0.95
PIT4260001:Prl7a2 UTSW 13 27659276 nonsense probably null
R0733:Prl7a2 UTSW 13 27662688 missense probably damaging 1.00
R1371:Prl7a2 UTSW 13 27662767 missense probably benign 0.01
R1778:Prl7a2 UTSW 13 27659271 missense probably damaging 0.98
R1857:Prl7a2 UTSW 13 27659180 nonsense probably null
R2063:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2064:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2065:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2067:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2068:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2176:Prl7a2 UTSW 13 27659106 missense probably benign 0.10
R2213:Prl7a2 UTSW 13 27665068 missense probably benign 0.06
R4111:Prl7a2 UTSW 13 27665067 missense possibly damaging 0.96
R4459:Prl7a2 UTSW 13 27665996 missense probably benign 0.21
R4483:Prl7a2 UTSW 13 27660947 missense possibly damaging 0.80
R4722:Prl7a2 UTSW 13 27660875 missense probably damaging 1.00
R5360:Prl7a2 UTSW 13 27659160 missense probably benign 0.22
R5778:Prl7a2 UTSW 13 27661000 nonsense probably null
R6667:Prl7a2 UTSW 13 27661041 missense probably benign 0.03
R7107:Prl7a2 UTSW 13 27659093 missense possibly damaging 0.89
R7600:Prl7a2 UTSW 13 27659281 missense possibly damaging 0.63
R8447:Prl7a2 UTSW 13 27665958 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TGCAGAAGTCACATCATTCATG -3'
(R):5'- TACAGGAAGGTCTAATGTCAGAATTGC -3'

Sequencing Primer
(F):5'- CGAGTTGAGTATACTCTGGG -3'
(R):5'- GCTTGTCTCATAGAAAACCAA -3'
Posted On2020-07-28