Incidental Mutation 'R8298:Zfp169'
ID 639100
Institutional Source Beutler Lab
Gene Symbol Zfp169
Ensembl Gene ENSMUSG00000050954
Gene Name zinc finger protein 169
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R8298 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 48487647-48513451 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 48498377 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 68 (Q68*)
Ref Sequence ENSEMBL: ENSMUSP00000134793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110110] [ENSMUST00000167682] [ENSMUST00000176176] [ENSMUST00000176949] [ENSMUST00000176996] [ENSMUST00000177530]
AlphaFold E9Q3R6
Predicted Effect probably null
Transcript: ENSMUST00000110110
AA Change: Q68*
SMART Domains Protein: ENSMUSP00000105737
Gene: ENSMUSG00000050954
AA Change: Q68*

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167682
AA Change: Q68*
SMART Domains Protein: ENSMUSP00000127591
Gene: ENSMUSG00000050954
AA Change: Q68*

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176176
AA Change: Q68*
SMART Domains Protein: ENSMUSP00000134793
Gene: ENSMUSG00000050954
AA Change: Q68*

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176949
AA Change: Q68*
SMART Domains Protein: ENSMUSP00000135695
Gene: ENSMUSG00000050954
AA Change: Q68*

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176996
AA Change: Q68*
SMART Domains Protein: ENSMUSP00000135520
Gene: ENSMUSG00000050954
AA Change: Q68*

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably null
Transcript: ENSMUST00000177530
AA Change: Q68*
SMART Domains Protein: ENSMUSP00000135414
Gene: ENSMUSG00000050954
AA Change: Q68*

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (62/64)
MGI Phenotype PHENOTYPE: Homozygous disruption of this locus does not result in an overt phenotype early in life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P16Rik A C 4: 104,948,831 E369D probably damaging Het
4930453N24Rik A G 16: 64,766,332 L343P probably benign Het
Aak1 T A 6: 86,925,079 F77I possibly damaging Het
Abca3 T C 17: 24,385,401 L582P probably damaging Het
Acat1 A T 9: 53,594,424 S136R probably damaging Het
Adamts2 T C 11: 50,777,131 F507L possibly damaging Het
Adcy3 G A 12: 4,206,482 A763T probably damaging Het
Adgrv1 A T 13: 81,385,914 C5849* probably null Het
Adrb2 A T 18: 62,178,682 N357K probably benign Het
Ak9 A G 10: 41,389,058 E404G Het
Akap13 T C 7: 75,747,804 L2576P probably damaging Het
Armcx5 AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA X: 135,745,704 probably benign Het
Arv1 A G 8: 124,728,372 Y108C probably damaging Het
Casp8ap2 T A 4: 32,640,429 H494Q probably benign Het
Ccdc88b A G 19: 6,850,281 L951P probably damaging Het
D830039M14Rik A T 10: 61,475,583 M160K noncoding transcript Het
Dbf4 A G 5: 8,412,115 probably benign Het
Dennd4a A G 9: 64,906,875 D1458G probably benign Het
Dock10 T C 1: 80,536,937 K1422R probably benign Het
Dyrk3 C T 1: 131,129,375 D354N probably damaging Het
Epha3 T A 16: 63,566,598 I892F probably benign Het
Evi5 G A 5: 107,816,865 S317L possibly damaging Het
Evl C T 12: 108,652,973 P76S probably benign Het
Gm1000 T C 12: 104,476,177 probably benign Het
Gm1979 T C 5: 26,001,150 N190S probably damaging Het
Gm3633 T C 14: 42,640,718 E72G Het
Gm5414 T C 15: 101,624,170 Y506C unknown Het
Gm572 T A 4: 148,658,093 H96Q possibly damaging Het
Gml T C 15: 74,813,692 E148G probably damaging Het
Got1l1 T C 8: 27,198,558 D255G probably benign Het
Hydin A G 8: 110,600,383 N4785D probably damaging Het
Kcnk12 A T 17: 87,797,285 F57Y probably damaging Het
Klhdc9 C A 1: 171,358,861 G336C probably damaging Het
Kprp T C 3: 92,825,300 T148A probably damaging Het
Lama3 G A 18: 12,525,853 R2022Q probably benign Het
Lelp1 A T 3: 92,135,620 S41T unknown Het
Lnx2 A T 5: 147,024,517 M535K probably benign Het
Mmp9 T A 2: 164,950,359 F294L probably null Het
Myo7a T C 7: 98,098,334 Y97C probably damaging Het
Nav2 T C 7: 49,554,261 probably null Het
Ndufaf3 T C 9: 108,566,921 T3A probably benign Het
Nrxn1 A G 17: 90,704,169 I344T probably damaging Het
Olfr1020 T C 2: 85,850,189 S246P probably damaging Het
Olfr1137 A T 2: 87,711,032 S291R probably damaging Het
Olfr3 T C 2: 36,813,026 E22G probably benign Het
Pccb T C 9: 100,985,832 D384G probably damaging Het
Plekhg3 C T 12: 76,577,078 H1032Y probably damaging Het
Ppfia3 A G 7: 45,360,194 S125P probably damaging Het
Prl7a2 T C 13: 27,661,011 M131V probably benign Het
Prmt3 A G 7: 49,857,438 T517A probably benign Het
Prpf4b A G 13: 34,888,183 H491R unknown Het
Rhot1 T A 11: 80,246,676 C335S probably benign Het
Robo1 C T 16: 72,972,132 probably benign Het
Samd3 A T 10: 26,245,570 D195V probably damaging Het
Sh3gl2 T A 4: 85,379,410 D208E possibly damaging Het
Spta1 A T 1: 174,247,387 D2393V probably damaging Het
Tgs1 T C 4: 3,605,840 L785P probably damaging Het
Tmem25 C T 9: 44,798,819 probably benign Het
Trappc10 A G 10: 78,202,919 Y780H probably damaging Het
Ttn C A 2: 76,727,167 W29861L probably damaging Het
Usp1 T A 4: 98,930,899 D199E probably damaging Het
Vmn2r40 A G 7: 8,908,149 I715T Het
Zfp418 T A 7: 7,182,815 Y592* probably null Het
Zfp712 A G 13: 67,040,912 V517A probably benign Het
Zfp934 A T 13: 62,518,481 H146Q Het
Zgrf1 T C 3: 127,615,229 S1662P probably damaging Het
Other mutations in Zfp169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:Zfp169 APN 13 48490763 unclassified probably benign
IGL03329:Zfp169 APN 13 48490794 unclassified probably benign
IGL03382:Zfp169 APN 13 48491163 unclassified probably benign
IGL03394:Zfp169 APN 13 48489924 missense possibly damaging 0.93
BB010:Zfp169 UTSW 13 48490481 missense unknown
BB020:Zfp169 UTSW 13 48490481 missense unknown
R0571:Zfp169 UTSW 13 48489690 missense possibly damaging 0.71
R1714:Zfp169 UTSW 13 48498854 missense probably benign 0.35
R1784:Zfp169 UTSW 13 48489819 missense possibly damaging 0.61
R3108:Zfp169 UTSW 13 48489996 missense possibly damaging 0.86
R3689:Zfp169 UTSW 13 48506901 splice site probably benign
R4444:Zfp169 UTSW 13 48490337 missense possibly damaging 0.94
R4665:Zfp169 UTSW 13 48490863 unclassified probably benign
R4719:Zfp169 UTSW 13 48490158 missense probably benign 0.06
R4745:Zfp169 UTSW 13 48490232 missense possibly damaging 0.71
R5288:Zfp169 UTSW 13 48490275 missense possibly damaging 0.61
R5384:Zfp169 UTSW 13 48490275 missense possibly damaging 0.61
R5979:Zfp169 UTSW 13 48491040 unclassified probably benign
R6053:Zfp169 UTSW 13 48498858 missense probably damaging 1.00
R6823:Zfp169 UTSW 13 48490996 unclassified probably benign
R7084:Zfp169 UTSW 13 48498863 missense probably benign 0.10
R7679:Zfp169 UTSW 13 48498383 missense probably damaging 0.99
R7933:Zfp169 UTSW 13 48490481 missense unknown
R8322:Zfp169 UTSW 13 48491099 missense unknown
R9047:Zfp169 UTSW 13 48498816 missense probably damaging 1.00
R9124:Zfp169 UTSW 13 48491081 missense unknown
R9126:Zfp169 UTSW 13 48491081 missense unknown
R9131:Zfp169 UTSW 13 48491081 missense unknown
R9132:Zfp169 UTSW 13 48491081 missense unknown
Predicted Primers PCR Primer
(F):5'- GTCTCCTAGCAACTGTGAGC -3'
(R):5'- GACCCTGCTTTTGACCTAGG -3'

Sequencing Primer
(F):5'- TGAGAGAGGCAGTGCTACCC -3'
(R):5'- GACCTAGGATCCTCTGCCC -3'
Posted On 2020-07-28