Incidental Mutation 'R0703:Ldhb'
ID63911
Institutional Source Beutler Lab
Gene Symbol Ldhb
Ensembl Gene ENSMUSG00000030246
Gene Namelactate dehydrogenase B
SynonymsLdh-2, lactate dehydrogenase-B, H-Ldh
MMRRC Submission 038886-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0703 (G1)
Quality Score129
Status Not validated
Chromosome6
Chromosomal Location142490249-142507957 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 142495601 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 188 (G188R)
Ref Sequence ENSEMBL: ENSMUSP00000116014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032373] [ENSMUST00000134191]
Predicted Effect probably damaging
Transcript: ENSMUST00000032373
AA Change: G188R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032373
Gene: ENSMUSG00000030246
AA Change: G188R

DomainStartEndE-ValueType
Pfam:Ldh_1_N 22 161 4.2e-51 PFAM
Pfam:Ldh_1_C 164 334 9.6e-25 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000130817
AA Change: G16R
Predicted Effect probably damaging
Transcript: ENSMUST00000134191
AA Change: G188R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116014
Gene: ENSMUSG00000030246
AA Change: G188R

DomainStartEndE-ValueType
Pfam:Ldh_1_N 22 161 6.3e-54 PFAM
Pfam:Glyco_hydro_4 79 178 2.1e-8 PFAM
Pfam:Ldh_1_C 164 198 1.7e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000204433
AA Change: G121R
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the B subunit of lactate dehydrogenase enzyme, which catalyzes the interconversion of pyruvate and lactate with concomitant interconversion of NADH and NAD+ in a post-glycolysis process. Alternatively spliced transcript variants have also been found for this gene. Recent studies have shown that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is localized in the peroxisomes. Pseudogenes have been identified on chromosomes 1 and 19. [provided by RefSeq, Feb 2016]
PHENOTYPE: Electrophoretic variants of LDHB are determined by: the a allele with fast anodal mobility in all inbred strains tested; and the b allele with slower mobility in Peru-Coppock stock. Three additional variants are known in wild M. spretus from southern France and Spain. Alleles are codominant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 9 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 C T 13: 104,352,847 H403Y probably damaging Het
Cfap70 T A 14: 20,439,715 I248F probably damaging Het
Gpam A G 19: 55,072,756 Y775H probably benign Het
Hpgd T C 8: 56,295,039 V65A probably damaging Het
Lair1 A T 7: 4,010,760 C163S probably null Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Serpinb9b C A 13: 33,032,981 N78K probably benign Het
Socs4 C T 14: 47,290,048 H147Y probably damaging Het
Utp23 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 15: 51,882,356 probably benign Het
Other mutations in Ldhb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02133:Ldhb APN 6 142492500 missense probably benign 0.16
IGL02215:Ldhb APN 6 142495566 critical splice donor site probably null
IGL03094:Ldhb APN 6 142505527 missense probably benign 0.00
IGL03337:Ldhb APN 6 142494156 missense probably benign
R0347:Ldhb UTSW 6 142494133 missense probably benign 0.00
R1531:Ldhb UTSW 6 142501395 missense probably benign 0.09
R1577:Ldhb UTSW 6 142492598 missense possibly damaging 0.87
R1844:Ldhb UTSW 6 142494208 missense probably damaging 1.00
R2151:Ldhb UTSW 6 142498670 missense possibly damaging 0.76
R3500:Ldhb UTSW 6 142501447 missense probably damaging 1.00
R4502:Ldhb UTSW 6 142490457 missense possibly damaging 0.60
R5139:Ldhb UTSW 6 142494195 missense probably damaging 1.00
R5214:Ldhb UTSW 6 142495595 missense probably damaging 1.00
R6499:Ldhb UTSW 6 142494121 missense possibly damaging 0.92
R6525:Ldhb UTSW 6 142490465 missense probably benign
R6598:Ldhb UTSW 6 142490600 missense possibly damaging 0.56
R7096:Ldhb UTSW 6 142501373 missense probably benign 0.09
R7399:Ldhb UTSW 6 142495673 missense probably damaging 0.99
R7565:Ldhb UTSW 6 142492519 missense possibly damaging 0.67
R8447:Ldhb UTSW 6 142498630 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCATCGTGCCCAAGAATGAGTGAC -3'
(R):5'- CTGCCTGACCCAACTGTGAGAATC -3'

Sequencing Primer
(F):5'- ccaggcgggatgaccag -3'
(R):5'- AATTGGCTGAGCAGTTCCC -3'
Posted On2013-07-30