Incidental Mutation 'R8299:Clstn3'
ID639131
Institutional Source Beutler Lab
Gene Symbol Clstn3
Ensembl Gene ENSMUSG00000008153
Gene Namecalsyntenin 3
Synonymsalcadein-beta, Cst-3, CSTN3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8299 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location124430759-124464794 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 124437373 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000008297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008297] [ENSMUST00000112523]
Predicted Effect probably null
Transcript: ENSMUST00000008297
SMART Domains Protein: ENSMUSP00000008297
Gene: ENSMUSG00000008153

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CA 50 143 2.72e-12 SMART
CA 166 244 4.04e-2 SMART
SCOP:d1a8d_1 333 549 7e-23 SMART
transmembrane domain 846 868 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112523
SMART Domains Protein: ENSMUSP00000108142
Gene: ENSMUSG00000008153

DomainStartEndE-ValueType
CA 13 106 2.72e-12 SMART
CA 129 207 4.04e-2 SMART
Pfam:Laminin_G_3 304 505 4.1e-8 PFAM
transmembrane domain 809 831 N/A INTRINSIC
low complexity region 891 908 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reductions in excitatory and inhibitory synapse density and deficits in synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 C A 10: 69,976,151 P1216Q probably damaging Het
Aspscr1 T C 11: 120,709,074 Y164H Het
Atp13a3 A C 16: 30,333,801 F1021C probably damaging Het
Bcl9 T C 3: 97,205,536 D1201G probably damaging Het
Bora G A 14: 99,068,134 R313Q probably benign Het
Cdh19 A G 1: 110,919,548 Y444H probably benign Het
Cep70 A T 9: 99,262,861 M87L possibly damaging Het
Cntnap4 G A 8: 112,773,692 G539S probably damaging Het
Csf2rb T A 15: 78,346,469 Y471N possibly damaging Het
Dctn4 T A 18: 60,545,800 I197N probably benign Het
Ednrb A G 14: 103,823,500 L163P probably damaging Het
Elovl2 T C 13: 41,191,920 N101D probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Etl4 T A 2: 20,744,063 I404K possibly damaging Het
Gadd45a A G 6: 67,037,199 probably null Het
Gfod2 T C 8: 105,728,162 T29A probably benign Het
Hltf A G 3: 20,082,822 K408E possibly damaging Het
Inf2 A G 12: 112,604,112 T362A probably benign Het
Klhl12 G A 1: 134,488,940 G467R probably damaging Het
Lrrk2 A T 15: 91,673,240 probably benign Het
Mcee G A 7: 64,411,873 E29K unknown Het
Mki67 A T 7: 135,704,620 I571N probably damaging Het
Morc3 T C 16: 93,853,200 Y290H probably damaging Het
Muc4 A G 16: 32,755,897 T1924A unknown Het
Myh14 T A 7: 44,627,048 D1170V probably damaging Het
Olfr121 G T 17: 37,752,000 E49* probably null Het
Olfr544 T C 7: 102,484,202 H306R probably benign Het
Olfr575 T C 7: 102,955,532 E30G probably damaging Het
Olfr798 T C 10: 129,625,960 I34V probably benign Het
Park2 T G 17: 11,237,521 S77R probably benign Het
Pcdhb17 T C 18: 37,485,355 I66T probably damaging Het
Pkhd1l1 T C 15: 44,581,934 V3734A probably benign Het
Plcb1 T C 2: 135,335,476 L576P probably damaging Het
Plxnc1 T A 10: 94,827,179 N1203Y probably benign Het
Pramef25 T C 4: 143,950,757 N84S probably benign Het
Rev3l C T 10: 39,821,541 S678L probably benign Het
Rims3 T C 4: 120,889,372 Y197H probably damaging Het
S1pr4 A G 10: 81,499,433 M69T probably benign Het
Sf3a1 T C 11: 4,179,420 Y757H possibly damaging Het
Slc30a9 T A 5: 67,326,905 N128K probably damaging Het
Slc35a4 T C 18: 36,682,927 V270A possibly damaging Het
Soga1 T G 2: 157,020,731 E1426A possibly damaging Het
Speg A C 1: 75,387,836 D287A possibly damaging Het
St18 T C 1: 6,802,992 V317A probably benign Het
Stk11 G T 10: 80,128,033 E350D probably benign Het
Strn3 A G 12: 51,648,107 L291S probably damaging Het
Susd1 C T 4: 59,315,773 V733I probably benign Het
Tep1 T C 14: 50,868,045 R173G probably benign Het
Tmem115 T C 9: 107,534,546 V23A possibly damaging Het
Top2b A G 14: 16,386,123 N110D possibly damaging Het
Wfikkn2 C T 11: 94,239,064 V84M probably damaging Het
Other mutations in Clstn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Clstn3 APN 6 124462139 missense probably damaging 1.00
IGL01415:Clstn3 APN 6 124438822 nonsense probably null
IGL01521:Clstn3 APN 6 124458031 nonsense probably null
IGL01537:Clstn3 APN 6 124431600 missense possibly damaging 0.91
IGL01729:Clstn3 APN 6 124449794 missense probably benign 0.06
IGL01879:Clstn3 APN 6 124438810 missense probably damaging 1.00
IGL01998:Clstn3 APN 6 124458663 missense probably damaging 1.00
IGL03130:Clstn3 APN 6 124459263 missense probably damaging 0.98
IGL03405:Clstn3 APN 6 124438368 missense possibly damaging 0.95
PIT4403001:Clstn3 UTSW 6 124458023 missense probably damaging 1.00
R0049:Clstn3 UTSW 6 124459853 missense possibly damaging 0.87
R0049:Clstn3 UTSW 6 124459853 missense possibly damaging 0.87
R0208:Clstn3 UTSW 6 124432169 splice site probably benign
R0276:Clstn3 UTSW 6 124431740 splice site probably benign
R0440:Clstn3 UTSW 6 124451413 missense probably damaging 1.00
R0612:Clstn3 UTSW 6 124449500 missense probably damaging 0.98
R1200:Clstn3 UTSW 6 124459170 missense probably damaging 1.00
R1224:Clstn3 UTSW 6 124457919 missense probably benign
R1378:Clstn3 UTSW 6 124438419 missense probably damaging 1.00
R1491:Clstn3 UTSW 6 124437490 missense possibly damaging 0.51
R1495:Clstn3 UTSW 6 124449917 missense probably benign 0.00
R1511:Clstn3 UTSW 6 124462169 missense probably damaging 1.00
R1655:Clstn3 UTSW 6 124437427 missense probably damaging 1.00
R1731:Clstn3 UTSW 6 124431632 missense probably benign 0.04
R1734:Clstn3 UTSW 6 124436814 splice site probably benign
R1751:Clstn3 UTSW 6 124431999 missense probably damaging 1.00
R1954:Clstn3 UTSW 6 124459298 missense possibly damaging 0.94
R2133:Clstn3 UTSW 6 124449503 missense probably benign
R2192:Clstn3 UTSW 6 124459207 missense probably damaging 1.00
R2314:Clstn3 UTSW 6 124450717 missense probably benign 0.39
R2874:Clstn3 UTSW 6 124438335 missense probably damaging 1.00
R3500:Clstn3 UTSW 6 124431711 missense probably benign 0.01
R3761:Clstn3 UTSW 6 124457876 missense possibly damaging 0.54
R3878:Clstn3 UTSW 6 124457942 missense probably damaging 0.97
R3927:Clstn3 UTSW 6 124451368 missense probably damaging 1.00
R3934:Clstn3 UTSW 6 124457942 missense probably damaging 0.97
R3935:Clstn3 UTSW 6 124457942 missense probably damaging 0.97
R4063:Clstn3 UTSW 6 124449833 missense possibly damaging 0.51
R4402:Clstn3 UTSW 6 124456980 missense probably damaging 0.96
R4534:Clstn3 UTSW 6 124459220 missense probably damaging 1.00
R4785:Clstn3 UTSW 6 124437372 splice site probably null
R4834:Clstn3 UTSW 6 124431953 splice site probably null
R5921:Clstn3 UTSW 6 124431580 utr 3 prime probably benign
R5932:Clstn3 UTSW 6 124438332 missense probably benign 0.01
R6025:Clstn3 UTSW 6 124431664 missense possibly damaging 0.73
R6101:Clstn3 UTSW 6 124461670 missense probably damaging 1.00
R6360:Clstn3 UTSW 6 124438429 missense possibly damaging 0.88
R6578:Clstn3 UTSW 6 124450704 critical splice donor site probably null
R6813:Clstn3 UTSW 6 124436935 missense probably benign 0.00
R7380:Clstn3 UTSW 6 124456989 missense probably benign 0.01
R7419:Clstn3 UTSW 6 124458129 missense probably benign 0.05
R7625:Clstn3 UTSW 6 124437418 nonsense probably null
R7780:Clstn3 UTSW 6 124462202 missense probably damaging 0.98
R7936:Clstn3 UTSW 6 124432013 missense possibly damaging 0.73
R7939:Clstn3 UTSW 6 124462199 missense probably damaging 1.00
R8047:Clstn3 UTSW 6 124432013 missense possibly damaging 0.73
R8079:Clstn3 UTSW 6 124459804 missense probably damaging 1.00
R8085:Clstn3 UTSW 6 124458724 missense probably benign 0.23
R8406:Clstn3 UTSW 6 124462177 missense probably damaging 1.00
RF014:Clstn3 UTSW 6 124459266 nonsense probably null
X0066:Clstn3 UTSW 6 124449811 missense probably benign 0.13
Z1176:Clstn3 UTSW 6 124459200 missense probably damaging 1.00
Z1177:Clstn3 UTSW 6 124449781 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGTAAGCCATCTCTCCCATG -3'
(R):5'- TCCCACTGTATTGTCAGCTG -3'

Sequencing Primer
(F):5'- ATGCCCATCTCCCTAACTATCAG -3'
(R):5'- TTGGAGCCTGAGACTCACTGAG -3'
Posted On2020-07-28