Incidental Mutation 'R8299:Plxnc1'
ID639145
Institutional Source Beutler Lab
Gene Symbol Plxnc1
Ensembl Gene ENSMUSG00000074785
Gene Nameplexin C1
SynonymsCD232, vespr, 2510048K12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock #R8299 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location94790866-94944835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94827179 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 1203 (N1203Y)
Ref Sequence ENSEMBL: ENSMUSP00000096939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099337]
Predicted Effect probably benign
Transcript: ENSMUST00000099337
AA Change: N1203Y

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000096939
Gene: ENSMUSG00000074785
AA Change: N1203Y

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Sema 87 431 5.5e-10 PFAM
PSI 454 507 5.28e-12 SMART
PSI 590 634 1.07e-3 SMART
Pfam:TIG 665 752 3.7e-9 PFAM
IPT 755 847 5.14e-7 SMART
IPT 849 954 1.8e-2 SMART
low complexity region 978 997 N/A INTRINSIC
Pfam:Plexin_cytopl 1018 1541 1.4e-199 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin family. Plexins are transmembrane receptors for semaphorins, a large family of proteins that regulate axon guidance, cell motility and migration, and the immune response. The encoded protein and its ligand regulate melanocyte adhesion, and viral semaphorins may modulate the immune response by binding to this receptor. The encoded protein may be a tumor suppressor protein for melanoma. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuron morphology and migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 C A 10: 69,976,151 P1216Q probably damaging Het
Aspscr1 T C 11: 120,709,074 Y164H Het
Atp13a3 A C 16: 30,333,801 F1021C probably damaging Het
Bcl9 T C 3: 97,205,536 D1201G probably damaging Het
Bora G A 14: 99,068,134 R313Q probably benign Het
Cdh19 A G 1: 110,919,548 Y444H probably benign Het
Cep70 A T 9: 99,262,861 M87L possibly damaging Het
Clstn3 A G 6: 124,437,373 probably null Het
Cntnap4 G A 8: 112,773,692 G539S probably damaging Het
Csf2rb T A 15: 78,346,469 Y471N possibly damaging Het
Dctn4 T A 18: 60,545,800 I197N probably benign Het
Ednrb A G 14: 103,823,500 L163P probably damaging Het
Elovl2 T C 13: 41,191,920 N101D probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Etl4 T A 2: 20,744,063 I404K possibly damaging Het
Gadd45a A G 6: 67,037,199 probably null Het
Gfod2 T C 8: 105,728,162 T29A probably benign Het
Hltf A G 3: 20,082,822 K408E possibly damaging Het
Inf2 A G 12: 112,604,112 T362A probably benign Het
Klhl12 G A 1: 134,488,940 G467R probably damaging Het
Lrrk2 A T 15: 91,673,240 probably benign Het
Mcee G A 7: 64,411,873 E29K unknown Het
Mki67 A T 7: 135,704,620 I571N probably damaging Het
Morc3 T C 16: 93,853,200 Y290H probably damaging Het
Muc4 A G 16: 32,755,897 T1924A unknown Het
Myh14 T A 7: 44,627,048 D1170V probably damaging Het
Olfr121 G T 17: 37,752,000 E49* probably null Het
Olfr544 T C 7: 102,484,202 H306R probably benign Het
Olfr575 T C 7: 102,955,532 E30G probably damaging Het
Olfr798 T C 10: 129,625,960 I34V probably benign Het
Park2 T G 17: 11,237,521 S77R probably benign Het
Pcdhb17 T C 18: 37,485,355 I66T probably damaging Het
Pkhd1l1 T C 15: 44,581,934 V3734A probably benign Het
Plcb1 T C 2: 135,335,476 L576P probably damaging Het
Pramef25 T C 4: 143,950,757 N84S probably benign Het
Rev3l C T 10: 39,821,541 S678L probably benign Het
Rims3 T C 4: 120,889,372 Y197H probably damaging Het
S1pr4 A G 10: 81,499,433 M69T probably benign Het
Sf3a1 T C 11: 4,179,420 Y757H possibly damaging Het
Slc30a9 T A 5: 67,326,905 N128K probably damaging Het
Slc35a4 T C 18: 36,682,927 V270A possibly damaging Het
Soga1 T G 2: 157,020,731 E1426A possibly damaging Het
Speg A C 1: 75,387,836 D287A possibly damaging Het
St18 T C 1: 6,802,992 V317A probably benign Het
Stk11 G T 10: 80,128,033 E350D probably benign Het
Strn3 A G 12: 51,648,107 L291S probably damaging Het
Susd1 C T 4: 59,315,773 V733I probably benign Het
Tep1 T C 14: 50,868,045 R173G probably benign Het
Tmem115 T C 9: 107,534,546 V23A possibly damaging Het
Top2b A G 14: 16,386,123 N110D possibly damaging Het
Wfikkn2 C T 11: 94,239,064 V84M probably damaging Het
Other mutations in Plxnc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Plxnc1 APN 10 94847549 missense probably benign 0.25
IGL01285:Plxnc1 APN 10 94799368 missense probably damaging 0.99
IGL01867:Plxnc1 APN 10 94798146 missense possibly damaging 0.61
IGL01994:Plxnc1 APN 10 94849939 missense probably damaging 1.00
IGL02083:Plxnc1 APN 10 94922725 missense possibly damaging 0.61
IGL02250:Plxnc1 APN 10 94871031 missense probably benign 0.00
IGL02429:Plxnc1 APN 10 94882591 missense probably benign 0.00
IGL02752:Plxnc1 APN 10 94794680 splice site probably null
IGL02973:Plxnc1 APN 10 94810684 missense probably damaging 1.00
R0230:Plxnc1 UTSW 10 94799347 missense probably benign 0.07
R0265:Plxnc1 UTSW 10 94813129 missense probably benign 0.14
R0271:Plxnc1 UTSW 10 94837918 missense probably null 1.00
R0299:Plxnc1 UTSW 10 94849821 critical splice donor site probably null
R0361:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
R0441:Plxnc1 UTSW 10 94796482 missense probably damaging 1.00
R0558:Plxnc1 UTSW 10 94837935 missense probably damaging 1.00
R0617:Plxnc1 UTSW 10 94799368 missense probably damaging 1.00
R0671:Plxnc1 UTSW 10 94799332 missense possibly damaging 0.63
R0692:Plxnc1 UTSW 10 94837500 critical splice donor site probably null
R0751:Plxnc1 UTSW 10 94831333 splice site probably benign
R1184:Plxnc1 UTSW 10 94831333 splice site probably benign
R1260:Plxnc1 UTSW 10 94831365 missense probably damaging 0.99
R1680:Plxnc1 UTSW 10 94841551 missense probably benign 0.14
R1746:Plxnc1 UTSW 10 94844179 splice site probably null
R1750:Plxnc1 UTSW 10 94799497 missense probably damaging 1.00
R1751:Plxnc1 UTSW 10 94849815 unclassified probably benign
R1768:Plxnc1 UTSW 10 94844322 missense probably benign 0.05
R1876:Plxnc1 UTSW 10 94866941 missense possibly damaging 0.94
R2004:Plxnc1 UTSW 10 94852622 missense probably damaging 0.98
R2031:Plxnc1 UTSW 10 94943667 missense probably benign 0.26
R2184:Plxnc1 UTSW 10 94944269 missense probably damaging 1.00
R2437:Plxnc1 UTSW 10 94906533 missense probably benign 0.02
R2927:Plxnc1 UTSW 10 94793292 critical splice acceptor site probably null
R3001:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3002:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3003:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3441:Plxnc1 UTSW 10 94871010 missense probably benign 0.00
R3849:Plxnc1 UTSW 10 94794432 missense probably benign 0.01
R3884:Plxnc1 UTSW 10 94910687 splice site probably null
R4004:Plxnc1 UTSW 10 94794597 nonsense probably null
R4679:Plxnc1 UTSW 10 94794444 missense probably damaging 1.00
R4730:Plxnc1 UTSW 10 94867468 intron probably benign
R4937:Plxnc1 UTSW 10 94841473 missense probably damaging 1.00
R5068:Plxnc1 UTSW 10 94799377 missense possibly damaging 0.91
R5345:Plxnc1 UTSW 10 94849969 missense probably benign 0.26
R5397:Plxnc1 UTSW 10 94843752 missense probably benign 0.08
R5416:Plxnc1 UTSW 10 94837554 missense probably damaging 1.00
R5485:Plxnc1 UTSW 10 94922742 missense probably benign 0.00
R5543:Plxnc1 UTSW 10 94864774 missense probably benign
R5826:Plxnc1 UTSW 10 94799473 critical splice donor site probably null
R6007:Plxnc1 UTSW 10 94793290 missense possibly damaging 0.88
R6018:Plxnc1 UTSW 10 94943848 missense probably benign 0.21
R6052:Plxnc1 UTSW 10 94943773 missense probably benign 0.13
R6291:Plxnc1 UTSW 10 94833642 splice site probably null
R6653:Plxnc1 UTSW 10 94943876 missense probably damaging 1.00
R6984:Plxnc1 UTSW 10 94831530 missense probably damaging 1.00
R7086:Plxnc1 UTSW 10 94831435 missense probably benign
R7401:Plxnc1 UTSW 10 94871005 missense probably benign
R7727:Plxnc1 UTSW 10 94944109 missense probably damaging 1.00
R7789:Plxnc1 UTSW 10 94794477 missense probably damaging 1.00
R7803:Plxnc1 UTSW 10 94943515 critical splice donor site probably null
R7809:Plxnc1 UTSW 10 94794440 missense probably damaging 1.00
R7882:Plxnc1 UTSW 10 94843836 missense probably benign
R8103:Plxnc1 UTSW 10 94871082 missense probably benign
R8226:Plxnc1 UTSW 10 94833368 missense possibly damaging 0.90
R8273:Plxnc1 UTSW 10 94813243 missense probably benign 0.14
R8392:Plxnc1 UTSW 10 94801490 missense possibly damaging 0.75
R8758:Plxnc1 UTSW 10 94922745 missense possibly damaging 0.91
R8806:Plxnc1 UTSW 10 94799278 missense probably damaging 1.00
R8882:Plxnc1 UTSW 10 94841566 missense probably damaging 1.00
R8893:Plxnc1 UTSW 10 94849847 missense probably benign 0.35
R8956:Plxnc1 UTSW 10 94910586 missense probably benign 0.00
RF003:Plxnc1 UTSW 10 94794444 missense probably damaging 1.00
RF045:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
RF046:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
RF047:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
X0024:Plxnc1 UTSW 10 94864715 critical splice donor site probably null
Z1176:Plxnc1 UTSW 10 94865029 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TTGGAAATTGACGAGTATCCCAG -3'
(R):5'- TCAGAGCTAACTGTTGCTTTTGC -3'

Sequencing Primer
(F):5'- ATTGACGAGTATCCCAGGCATCG -3'
(R):5'- GCAACTTTTTCCAAGGAGACTG -3'
Posted On2020-07-28