Incidental Mutation 'R8299:Aspscr1'
ID639149
Institutional Source Beutler Lab
Gene Symbol Aspscr1
Ensembl Gene ENSMUSG00000025142
Gene Namealveolar soft part sarcoma chromosome region, candidate 1 (human)
SynonymsASPCR1, RCC17, TUG, ASPC, ASPL, 1190006K01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8299 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location120672973-120709447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120709074 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 164 (Y164H)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026135] [ENSMUST00000026137] [ENSMUST00000026139] [ENSMUST00000055424] [ENSMUST00000103016] [ENSMUST00000106154] [ENSMUST00000106155] [ENSMUST00000106158] [ENSMUST00000106159] [ENSMUST00000106160] [ENSMUST00000145781] [ENSMUST00000151852] [ENSMUST00000168510] [ENSMUST00000168714] [ENSMUST00000168947]
Predicted Effect silent
Transcript: ENSMUST00000026135
SMART Domains Protein: ENSMUSP00000026135
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
Pfam:TUG-UBL1 15 78 1.4e-29 PFAM
low complexity region 193 206 N/A INTRINSIC
low complexity region 284 313 N/A INTRINSIC
coiled coil region 339 365 N/A INTRINSIC
UBX 378 459 1.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026137
SMART Domains Protein: ENSMUSP00000026137
Gene: ENSMUSG00000025144

DomainStartEndE-ValueType
Pfam:CENP-X 55 107 3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026139
SMART Domains Protein: ENSMUSP00000026139
Gene: ENSMUSG00000025145

DomainStartEndE-ValueType
LRR 57 84 9.11e0 SMART
LRR 85 112 1.01e-1 SMART
Blast:LRR 113 142 4e-11 BLAST
LRR 143 170 4.47e-3 SMART
LRR 171 198 2.2e-2 SMART
LRR 199 226 1.66e2 SMART
coiled coil region 360 645 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055424
SMART Domains Protein: ENSMUSP00000050335
Gene: ENSMUSG00000025144

DomainStartEndE-ValueType
Pfam:CENP-X 8 78 7.7e-25 PFAM
Predicted Effect silent
Transcript: ENSMUST00000103016
SMART Domains Protein: ENSMUSP00000099305
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
UBX 301 382 1.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106154
SMART Domains Protein: ENSMUSP00000101760
Gene: ENSMUSG00000025144

DomainStartEndE-ValueType
Pfam:CENP-X 44 114 6.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106155
SMART Domains Protein: ENSMUSP00000101761
Gene: ENSMUSG00000025144

DomainStartEndE-ValueType
low complexity region 39 50 N/A INTRINSIC
low complexity region 86 110 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000106158
SMART Domains Protein: ENSMUSP00000101764
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
Blast:UBX 301 361 2e-29 BLAST
SCOP:d1h8ca_ 308 364 2e-8 SMART
Predicted Effect silent
Transcript: ENSMUST00000106159
SMART Domains Protein: ENSMUSP00000101765
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
UBX 301 382 1.67e-1 SMART
Predicted Effect silent
Transcript: ENSMUST00000106160
SMART Domains Protein: ENSMUSP00000101766
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
Blast:UBX 301 361 2e-29 BLAST
SCOP:d1h8ca_ 308 364 2e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145781
SMART Domains Protein: ENSMUSP00000123038
Gene: ENSMUSG00000025145

DomainStartEndE-ValueType
LRR 57 84 9.11e0 SMART
LRR 85 112 1.01e-1 SMART
Blast:LRR 113 142 1e-10 BLAST
LRR 143 170 4.47e-3 SMART
LRR 171 198 2.2e-2 SMART
LRR 199 226 1.66e2 SMART
coiled coil region 360 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151852
SMART Domains Protein: ENSMUSP00000115298
Gene: ENSMUSG00000025145

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
Pfam:LRR_6 85 108 1e-2 PFAM
Blast:LRR 113 142 3e-11 BLAST
Pfam:LRR_6 143 162 7.6e-3 PFAM
Pfam:LRR_1 145 159 6.8e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166838
SMART Domains Protein: ENSMUSP00000127202
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
coiled coil region 49 75 N/A INTRINSIC
Blast:UBX 89 119 7e-13 BLAST
SCOP:d1i42a_ 92 119 4e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000128940
Gene: ENSMUSG00000025142
AA Change: Y164H

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
coiled coil region 37 63 N/A INTRINSIC
Blast:UBX 77 107 8e-13 BLAST
SCOP:d1i42a_ 80 107 5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168510
SMART Domains Protein: ENSMUSP00000125931
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
low complexity region 52 65 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168714
SMART Domains Protein: ENSMUSP00000129462
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
SCOP:d1h8ca_ 12 82 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168947
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a UBX domain and interacts with glucose transporter type 4 (GLUT4). This protein is a tether, which sequesters the GLUT4 in intracellular vesicles in muscle and fat cells in the absence of insulin, and redistributes the GLUT4 to the plasma membrane within minutes of insulin stimulation. Translocation t(X;17)(p11;q25) of this gene with transcription factor TFE3 gene results in a ASPSCR1-TFE3 fusion protein in alveolar soft part sarcoma and in renal cell carcinomas. Multiple alternatively spliced transcript variants have been found. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 C A 10: 69,976,151 P1216Q probably damaging Het
Atp13a3 A C 16: 30,333,801 F1021C probably damaging Het
Bcl9 T C 3: 97,205,536 D1201G probably damaging Het
Bora G A 14: 99,068,134 R313Q probably benign Het
Cdh19 A G 1: 110,919,548 Y444H probably benign Het
Cep70 A T 9: 99,262,861 M87L possibly damaging Het
Clstn3 A G 6: 124,437,373 probably null Het
Cntnap4 G A 8: 112,773,692 G539S probably damaging Het
Csf2rb T A 15: 78,346,469 Y471N possibly damaging Het
Dctn4 T A 18: 60,545,800 I197N probably benign Het
Ednrb A G 14: 103,823,500 L163P probably damaging Het
Elovl2 T C 13: 41,191,920 N101D probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Etl4 T A 2: 20,744,063 I404K possibly damaging Het
Gadd45a A G 6: 67,037,199 probably null Het
Gfod2 T C 8: 105,728,162 T29A probably benign Het
Hltf A G 3: 20,082,822 K408E possibly damaging Het
Inf2 A G 12: 112,604,112 T362A probably benign Het
Klhl12 G A 1: 134,488,940 G467R probably damaging Het
Lrrk2 A T 15: 91,673,240 probably benign Het
Mcee G A 7: 64,411,873 E29K unknown Het
Mki67 A T 7: 135,704,620 I571N probably damaging Het
Morc3 T C 16: 93,853,200 Y290H probably damaging Het
Muc4 A G 16: 32,755,897 T1924A unknown Het
Myh14 T A 7: 44,627,048 D1170V probably damaging Het
Olfr121 G T 17: 37,752,000 E49* probably null Het
Olfr544 T C 7: 102,484,202 H306R probably benign Het
Olfr575 T C 7: 102,955,532 E30G probably damaging Het
Olfr798 T C 10: 129,625,960 I34V probably benign Het
Park2 T G 17: 11,237,521 S77R probably benign Het
Pcdhb17 T C 18: 37,485,355 I66T probably damaging Het
Pkhd1l1 T C 15: 44,581,934 V3734A probably benign Het
Plcb1 T C 2: 135,335,476 L576P probably damaging Het
Plxnc1 T A 10: 94,827,179 N1203Y probably benign Het
Pramef25 T C 4: 143,950,757 N84S probably benign Het
Rev3l C T 10: 39,821,541 S678L probably benign Het
Rims3 T C 4: 120,889,372 Y197H probably damaging Het
S1pr4 A G 10: 81,499,433 M69T probably benign Het
Sf3a1 T C 11: 4,179,420 Y757H possibly damaging Het
Slc30a9 T A 5: 67,326,905 N128K probably damaging Het
Slc35a4 T C 18: 36,682,927 V270A possibly damaging Het
Soga1 T G 2: 157,020,731 E1426A possibly damaging Het
Speg A C 1: 75,387,836 D287A possibly damaging Het
St18 T C 1: 6,802,992 V317A probably benign Het
Stk11 G T 10: 80,128,033 E350D probably benign Het
Strn3 A G 12: 51,648,107 L291S probably damaging Het
Susd1 C T 4: 59,315,773 V733I probably benign Het
Tep1 T C 14: 50,868,045 R173G probably benign Het
Tmem115 T C 9: 107,534,546 V23A possibly damaging Het
Top2b A G 14: 16,386,123 N110D possibly damaging Het
Wfikkn2 C T 11: 94,239,064 V84M probably damaging Het
Other mutations in Aspscr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02588:Aspscr1 APN 11 120677531 missense possibly damaging 0.93
IGL02683:Aspscr1 APN 11 120701226 missense probably damaging 1.00
IGL02719:Aspscr1 APN 11 120677579 missense probably damaging 1.00
I1329:Aspscr1 UTSW 11 120701240 missense probably damaging 0.99
R0113:Aspscr1 UTSW 11 120688925 missense probably damaging 1.00
R0277:Aspscr1 UTSW 11 120678420 missense probably damaging 1.00
R0323:Aspscr1 UTSW 11 120678420 missense probably damaging 1.00
R0457:Aspscr1 UTSW 11 120677618 missense probably benign 0.35
R0714:Aspscr1 UTSW 11 120703667 critical splice donor site probably null
R1435:Aspscr1 UTSW 11 120689222 missense probably benign 0.00
R1509:Aspscr1 UTSW 11 120701516 missense probably damaging 1.00
R1739:Aspscr1 UTSW 11 120678516 missense probably damaging 1.00
R1789:Aspscr1 UTSW 11 120688560 missense probably damaging 1.00
R1958:Aspscr1 UTSW 11 120689208 missense probably null 1.00
R2414:Aspscr1 UTSW 11 120689222 missense probably benign 0.00
R2432:Aspscr1 UTSW 11 120702566 intron probably benign
R4059:Aspscr1 UTSW 11 120686679 missense probably benign 0.22
R4159:Aspscr1 UTSW 11 120708676 missense probably damaging 1.00
R4703:Aspscr1 UTSW 11 120688945 missense possibly damaging 0.87
R4705:Aspscr1 UTSW 11 120688945 missense possibly damaging 0.87
R4748:Aspscr1 UTSW 11 120701507 missense probably damaging 0.99
R5141:Aspscr1 UTSW 11 120689177 missense probably benign 0.01
R5869:Aspscr1 UTSW 11 120688920 missense possibly damaging 0.55
R7543:Aspscr1 UTSW 11 120709423 missense unknown
R7555:Aspscr1 UTSW 11 120673100 missense unknown
R7609:Aspscr1 UTSW 11 120677522 missense probably damaging 0.99
R7670:Aspscr1 UTSW 11 120689039 missense probably benign 0.00
R7946:Aspscr1 UTSW 11 120708617 missense
R7999:Aspscr1 UTSW 11 120678522 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGTGCAGGTCTCATCTGTG -3'
(R):5'- CACAAACCCCTGAGTTCCTG -3'

Sequencing Primer
(F):5'- CAGGTCTCATCTGTGGCTGAG -3'
(R):5'- ACCCAGCTAGTCCATGGCAG -3'
Posted On2020-07-28