Incidental Mutation 'R0703:Adamts6'
ID 63915
Institutional Source Beutler Lab
Gene Symbol Adamts6
Ensembl Gene ENSMUSG00000046169
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 6
Synonyms b2b2029Clo, b2b2182Clo, b2b2187.1Clo, b2b1879.1Clo, A930019D11Rik, ADAM-TS6, b2b2228Clo
MMRRC Submission 038886-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.831) question?
Stock # R0703 (G1)
Quality Score 147
Status Not validated
Chromosome 13
Chromosomal Location 104424343-104633203 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 104489355 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 403 (H403Y)
Ref Sequence ENSEMBL: ENSMUSP00000153665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065766] [ENSMUST00000223562] [ENSMUST00000224208] [ENSMUST00000224303] [ENSMUST00000224504] [ENSMUST00000224742] [ENSMUST00000224784]
AlphaFold D3Z1A5
Predicted Effect probably damaging
Transcript: ENSMUST00000065766
AA Change: H403Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064570
Gene: ENSMUSG00000046169
AA Change: H403Y

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 191 4.2e-40 PFAM
Pfam:Reprolysin_5 248 443 3.8e-17 PFAM
Pfam:Reprolysin_4 248 464 4.9e-12 PFAM
Pfam:Reprolysin 250 468 1.6e-27 PFAM
Pfam:Reprolysin_2 268 458 5.6e-15 PFAM
Pfam:Reprolysin_3 272 414 2.6e-14 PFAM
TSP1 561 613 3.98e-13 SMART
Pfam:ADAM_spacer1 717 829 2.9e-41 PFAM
TSP1 843 900 2.49e-5 SMART
TSP1 902 960 2.87e-5 SMART
TSP1 963 1018 1.36e-1 SMART
TSP1 1021 1069 2.36e-6 SMART
Pfam:PLAC 1083 1115 3.9e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223562
AA Change: H403Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224208
AA Change: H403Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000224303
Predicted Effect probably benign
Transcript: ENSMUST00000224504
Predicted Effect probably benign
Transcript: ENSMUST00000224742
Predicted Effect probably damaging
Transcript: ENSMUST00000224784
AA Change: H403Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature enzyme. Expression of this gene may be regulated by the cytokine TNF-alpha. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for induced mutations exhibit cardiovascular defects including double outlet right ventricle, ventricular septal defects and biventricular hypertrophy, and hydrops, thymus hypoplasia short snout and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 9 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cfap70 T A 14: 20,489,783 (GRCm39) I248F probably damaging Het
Gpam A G 19: 55,061,188 (GRCm39) Y775H probably benign Het
Hpgd T C 8: 56,748,074 (GRCm39) V65A probably damaging Het
Lair1 A T 7: 4,013,759 (GRCm39) C163S probably null Het
Ldhb C T 6: 142,441,327 (GRCm39) G188R probably damaging Het
Polr3a G A 14: 24,534,232 (GRCm39) P91L probably damaging Het
Serpinb9b C A 13: 33,216,964 (GRCm39) N78K probably benign Het
Socs4 C T 14: 47,527,505 (GRCm39) H147Y probably damaging Het
Utp23 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 15: 51,745,752 (GRCm39) probably benign Het
Other mutations in Adamts6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Adamts6 APN 13 104,566,298 (GRCm39) missense possibly damaging 0.79
IGL00583:Adamts6 APN 13 104,433,726 (GRCm39) nonsense probably null
IGL01305:Adamts6 APN 13 104,526,590 (GRCm39) missense probably damaging 1.00
IGL01448:Adamts6 APN 13 104,433,672 (GRCm39) missense probably damaging 1.00
IGL01517:Adamts6 APN 13 104,526,700 (GRCm39) splice site probably benign
IGL01678:Adamts6 APN 13 104,450,196 (GRCm39) missense probably damaging 1.00
IGL01737:Adamts6 APN 13 104,526,643 (GRCm39) missense probably damaging 0.99
IGL02152:Adamts6 APN 13 104,450,168 (GRCm39) missense probably null 1.00
IGL02217:Adamts6 APN 13 104,598,873 (GRCm39) splice site probably benign
IGL02828:Adamts6 APN 13 104,433,978 (GRCm39) missense probably damaging 1.00
IGL03067:Adamts6 APN 13 104,433,783 (GRCm39) missense probably damaging 1.00
IGL03081:Adamts6 APN 13 104,581,464 (GRCm39) utr 3 prime probably benign
IGL03159:Adamts6 APN 13 104,580,723 (GRCm39) missense probably damaging 1.00
IGL03411:Adamts6 APN 13 104,450,842 (GRCm39) missense possibly damaging 0.77
De_vito UTSW 13 104,483,900 (GRCm39) critical splice donor site probably null
festinator UTSW 13 104,616,043 (GRCm39) missense probably damaging 1.00
ANU22:Adamts6 UTSW 13 104,526,590 (GRCm39) missense probably damaging 1.00
P0007:Adamts6 UTSW 13 104,433,999 (GRCm39) missense possibly damaging 0.73
R0362:Adamts6 UTSW 13 104,526,584 (GRCm39) critical splice acceptor site probably null
R0504:Adamts6 UTSW 13 104,563,438 (GRCm39) splice site probably benign
R0549:Adamts6 UTSW 13 104,433,763 (GRCm39) missense possibly damaging 0.60
R0566:Adamts6 UTSW 13 104,581,435 (GRCm39) missense probably benign 0.00
R0799:Adamts6 UTSW 13 104,450,779 (GRCm39) missense probably damaging 1.00
R0838:Adamts6 UTSW 13 104,550,297 (GRCm39) missense possibly damaging 0.47
R1500:Adamts6 UTSW 13 104,449,389 (GRCm39) missense probably damaging 1.00
R1502:Adamts6 UTSW 13 104,630,145 (GRCm39) missense probably damaging 1.00
R1547:Adamts6 UTSW 13 104,581,383 (GRCm39) missense probably benign 0.26
R1619:Adamts6 UTSW 13 104,449,285 (GRCm39) missense probably benign 0.14
R1727:Adamts6 UTSW 13 104,565,472 (GRCm39) splice site probably benign
R1967:Adamts6 UTSW 13 104,563,459 (GRCm39) nonsense probably null
R2013:Adamts6 UTSW 13 104,450,812 (GRCm39) missense probably damaging 0.98
R2079:Adamts6 UTSW 13 104,598,746 (GRCm39) missense probably benign 0.00
R2432:Adamts6 UTSW 13 104,563,485 (GRCm39) missense probably benign 0.01
R3118:Adamts6 UTSW 13 104,450,787 (GRCm39) missense possibly damaging 0.91
R4125:Adamts6 UTSW 13 104,449,412 (GRCm39) missense probably damaging 1.00
R4274:Adamts6 UTSW 13 104,450,787 (GRCm39) missense possibly damaging 0.91
R4795:Adamts6 UTSW 13 104,580,636 (GRCm39) nonsense probably null
R4841:Adamts6 UTSW 13 104,449,295 (GRCm39) missense probably benign 0.00
R4976:Adamts6 UTSW 13 104,433,998 (GRCm39) missense probably damaging 0.98
R5085:Adamts6 UTSW 13 104,443,751 (GRCm39) missense probably damaging 0.99
R5234:Adamts6 UTSW 13 104,630,130 (GRCm39) missense probably damaging 1.00
R5403:Adamts6 UTSW 13 104,489,323 (GRCm39) missense possibly damaging 0.86
R5753:Adamts6 UTSW 13 104,483,858 (GRCm39) missense probably damaging 1.00
R6027:Adamts6 UTSW 13 104,616,043 (GRCm39) missense probably damaging 1.00
R6187:Adamts6 UTSW 13 104,433,933 (GRCm39) missense probably damaging 1.00
R6229:Adamts6 UTSW 13 104,483,900 (GRCm39) critical splice donor site probably null
R6243:Adamts6 UTSW 13 104,450,809 (GRCm39) missense probably damaging 0.99
R6257:Adamts6 UTSW 13 104,598,790 (GRCm39) missense probably benign
R6743:Adamts6 UTSW 13 104,565,436 (GRCm39) missense probably damaging 1.00
R6775:Adamts6 UTSW 13 104,450,160 (GRCm39) missense probably damaging 0.97
R7113:Adamts6 UTSW 13 104,449,267 (GRCm39) missense probably benign
R7351:Adamts6 UTSW 13 104,526,620 (GRCm39) missense possibly damaging 0.63
R7520:Adamts6 UTSW 13 104,433,694 (GRCm39) missense probably benign 0.01
R7866:Adamts6 UTSW 13 104,550,257 (GRCm39) nonsense probably null
R8274:Adamts6 UTSW 13 104,450,181 (GRCm39) missense probably benign 0.02
R8348:Adamts6 UTSW 13 104,616,027 (GRCm39) missense probably damaging 0.99
R8448:Adamts6 UTSW 13 104,616,027 (GRCm39) missense probably damaging 0.99
R8686:Adamts6 UTSW 13 104,450,207 (GRCm39) missense probably damaging 1.00
R8691:Adamts6 UTSW 13 104,450,839 (GRCm39) missense probably benign 0.00
R8962:Adamts6 UTSW 13 104,433,899 (GRCm39) missense probably damaging 0.99
R8978:Adamts6 UTSW 13 104,512,247 (GRCm39) missense probably damaging 1.00
R9075:Adamts6 UTSW 13 104,598,793 (GRCm39) missense probably benign
R9080:Adamts6 UTSW 13 104,449,427 (GRCm39) missense probably damaging 1.00
R9152:Adamts6 UTSW 13 104,613,275 (GRCm39) missense probably benign 0.06
R9213:Adamts6 UTSW 13 104,581,440 (GRCm39) missense probably damaging 1.00
R9536:Adamts6 UTSW 13 104,489,313 (GRCm39) missense probably benign 0.07
R9674:Adamts6 UTSW 13 104,563,448 (GRCm39) missense probably benign 0.17
X0065:Adamts6 UTSW 13 104,630,136 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGTTAACCTTTTGCCAACTGCTCC -3'
(R):5'- TCAAGTTCTTGGATTTACCCCAACACC -3'

Sequencing Primer
(F):5'- TGGAGGTTATTAAAAAGAATCCAGGC -3'
(R):5'- TTTACCCCAACACCCAAAATTATAAC -3'
Posted On 2013-07-30