Incidental Mutation 'R8299:Elovl2'
ID639152
Institutional Source Beutler Lab
Gene Symbol Elovl2
Ensembl Gene ENSMUSG00000021364
Gene Nameelongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2
SynonymsSsc2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R8299 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location41182381-41220405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41191920 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 101 (N101D)
Ref Sequence ENSEMBL: ENSMUSP00000021793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021793] [ENSMUST00000117096]
Predicted Effect probably benign
Transcript: ENSMUST00000021793
AA Change: N101D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021793
Gene: ENSMUSG00000021364
AA Change: N101D

DomainStartEndE-ValueType
Pfam:ELO 30 265 1.4e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117096
AA Change: N84D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114112
Gene: ENSMUSG00000021364
AA Change: N84D

DomainStartEndE-ValueType
Pfam:ELO 13 248 5.8e-67 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice heterozygous for a knock-out allele exhibit reduced male fertility. Mice homozygous for a knock-out allele exhibit male infertility associated with arrested spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 C A 10: 69,976,151 P1216Q probably damaging Het
Aspscr1 T C 11: 120,709,074 Y164H Het
Atp13a3 A C 16: 30,333,801 F1021C probably damaging Het
Bcl9 T C 3: 97,205,536 D1201G probably damaging Het
Bora G A 14: 99,068,134 R313Q probably benign Het
Cdh19 A G 1: 110,919,548 Y444H probably benign Het
Cep70 A T 9: 99,262,861 M87L possibly damaging Het
Clstn3 A G 6: 124,437,373 probably null Het
Cntnap4 G A 8: 112,773,692 G539S probably damaging Het
Csf2rb T A 15: 78,346,469 Y471N possibly damaging Het
Dctn4 T A 18: 60,545,800 I197N probably benign Het
Ednrb A G 14: 103,823,500 L163P probably damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Etl4 T A 2: 20,744,063 I404K possibly damaging Het
Gadd45a A G 6: 67,037,199 probably null Het
Gfod2 T C 8: 105,728,162 T29A probably benign Het
Hltf A G 3: 20,082,822 K408E possibly damaging Het
Inf2 A G 12: 112,604,112 T362A probably benign Het
Klhl12 G A 1: 134,488,940 G467R probably damaging Het
Lrrk2 A T 15: 91,673,240 probably benign Het
Mcee G A 7: 64,411,873 E29K unknown Het
Mki67 A T 7: 135,704,620 I571N probably damaging Het
Morc3 T C 16: 93,853,200 Y290H probably damaging Het
Muc4 A G 16: 32,755,897 T1924A unknown Het
Myh14 T A 7: 44,627,048 D1170V probably damaging Het
Olfr121 G T 17: 37,752,000 E49* probably null Het
Olfr544 T C 7: 102,484,202 H306R probably benign Het
Olfr575 T C 7: 102,955,532 E30G probably damaging Het
Olfr798 T C 10: 129,625,960 I34V probably benign Het
Park2 T G 17: 11,237,521 S77R probably benign Het
Pcdhb17 T C 18: 37,485,355 I66T probably damaging Het
Pkhd1l1 T C 15: 44,581,934 V3734A probably benign Het
Plcb1 T C 2: 135,335,476 L576P probably damaging Het
Plxnc1 T A 10: 94,827,179 N1203Y probably benign Het
Pramef25 T C 4: 143,950,757 N84S probably benign Het
Rev3l C T 10: 39,821,541 S678L probably benign Het
Rims3 T C 4: 120,889,372 Y197H probably damaging Het
S1pr4 A G 10: 81,499,433 M69T probably benign Het
Sf3a1 T C 11: 4,179,420 Y757H possibly damaging Het
Slc30a9 T A 5: 67,326,905 N128K probably damaging Het
Slc35a4 T C 18: 36,682,927 V270A possibly damaging Het
Soga1 T G 2: 157,020,731 E1426A possibly damaging Het
Speg A C 1: 75,387,836 D287A possibly damaging Het
St18 T C 1: 6,802,992 V317A probably benign Het
Stk11 G T 10: 80,128,033 E350D probably benign Het
Strn3 A G 12: 51,648,107 L291S probably damaging Het
Susd1 C T 4: 59,315,773 V733I probably benign Het
Tep1 T C 14: 50,868,045 R173G probably benign Het
Tmem115 T C 9: 107,534,546 V23A possibly damaging Het
Top2b A G 14: 16,386,123 N110D possibly damaging Het
Wfikkn2 C T 11: 94,239,064 V84M probably damaging Het
Other mutations in Elovl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Elovl2 APN 13 41185314 missense probably benign 0.01
IGL01769:Elovl2 APN 13 41186944 missense probably damaging 1.00
IGL02514:Elovl2 APN 13 41194771 missense probably benign 0.00
R0542:Elovl2 UTSW 13 41191976 splice site probably benign
R0765:Elovl2 UTSW 13 41187466 missense probably benign 0.17
R1076:Elovl2 UTSW 13 41190107 missense possibly damaging 0.83
R5562:Elovl2 UTSW 13 41185296 makesense probably null
R7860:Elovl2 UTSW 13 41187467 missense probably benign 0.04
Z1177:Elovl2 UTSW 13 41189978 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCACCCGGTCGTTTCTCAG -3'
(R):5'- CACTGTGAGTGGTGATCCCTTG -3'

Sequencing Primer
(F):5'- TCAGACATGGGCATCTCTAAGTC -3'
(R):5'- CAAAACTGGGTCTGATTCGGGAC -3'
Posted On2020-07-28