Incidental Mutation 'R8299:Ednrb'
ID 639156
Institutional Source Beutler Lab
Gene Symbol Ednrb
Ensembl Gene ENSMUSG00000022122
Gene Name endothelin receptor type B
Synonyms ETR-b, Sox10m1, ETb
MMRRC Submission 067787-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.716) question?
Stock # R8299 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 104052061-104081838 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104060936 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 163 (L163P)
Ref Sequence ENSEMBL: ENSMUSP00000022718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022718] [ENSMUST00000172237]
AlphaFold P48302
Predicted Effect probably damaging
Transcript: ENSMUST00000022718
AA Change: L163P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022718
Gene: ENSMUSG00000022122
AA Change: L163P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 329 2.3e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 8.5e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172237
AA Change: L163P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126057
Gene: ENSMUSG00000022122
AA Change: L163P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 328 1.9e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 4.2e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the G-protein coupled receptor family. It encodes a receptor for endothelins, peptides that are involved in vasocontriction. The encoded protein activates a phosphatidylinositol-calcium second messenger system and is required for the development of enteric neurons and melanocytes. Gene disruption causes pigmentation anomalies, deafness, and abnormal dilation of the colon due to defects of neural crest-derived cells. Mutations in this gene are found in the piebald mouse, and mouse models of Hirschsprung's disease and Waardenburg syndrome type 4. Renal collecting duct-specific gene deletion causes sodium retention and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for null mutations have pigmentation limited to small patches on the head and rump and die from megacolon resulting from impaired neural crest migration and aganglionosis. Heterozygotes for a null allele show improved cardiac tolerance to hypoxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 C A 10: 69,811,981 (GRCm39) P1216Q probably damaging Het
Aspscr1 T C 11: 120,599,900 (GRCm39) Y164H Het
Atp13a3 A C 16: 30,152,619 (GRCm39) F1021C probably damaging Het
Bcl9 T C 3: 97,112,852 (GRCm39) D1201G probably damaging Het
Bora G A 14: 99,305,570 (GRCm39) R313Q probably benign Het
Cdh19 A G 1: 110,847,278 (GRCm39) Y444H probably benign Het
Cep70 A T 9: 99,144,914 (GRCm39) M87L possibly damaging Het
Clstn3 A G 6: 124,414,332 (GRCm39) probably null Het
Cntnap4 G A 8: 113,500,324 (GRCm39) G539S probably damaging Het
Csf2rb T A 15: 78,230,669 (GRCm39) Y471N possibly damaging Het
Dctn4 T A 18: 60,678,872 (GRCm39) I197N probably benign Het
Elovl2 T C 13: 41,345,396 (GRCm39) N101D probably benign Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Etl4 T A 2: 20,748,874 (GRCm39) I404K possibly damaging Het
Gadd45a A G 6: 67,014,183 (GRCm39) probably null Het
Gfod2 T C 8: 106,454,794 (GRCm39) T29A probably benign Het
Hltf A G 3: 20,136,986 (GRCm39) K408E possibly damaging Het
Inf2 A G 12: 112,570,546 (GRCm39) T362A probably benign Het
Klhl12 G A 1: 134,416,678 (GRCm39) G467R probably damaging Het
Lrrk2 A T 15: 91,557,443 (GRCm39) probably benign Het
Mcee G A 7: 64,061,621 (GRCm39) E29K unknown Het
Mki67 A T 7: 135,306,349 (GRCm39) I571N probably damaging Het
Morc3 T C 16: 93,650,088 (GRCm39) Y290H probably damaging Het
Mtcl2 T G 2: 156,862,651 (GRCm39) E1426A possibly damaging Het
Muc4 A G 16: 32,576,271 (GRCm39) T1924A unknown Het
Myh14 T A 7: 44,276,472 (GRCm39) D1170V probably damaging Het
Or10al5 G T 17: 38,062,891 (GRCm39) E49* probably null Het
Or51a6 T C 7: 102,604,739 (GRCm39) E30G probably damaging Het
Or55b4 T C 7: 102,133,409 (GRCm39) H306R probably benign Het
Or6c66 T C 10: 129,461,829 (GRCm39) I34V probably benign Het
Pcdhb17 T C 18: 37,618,408 (GRCm39) I66T probably damaging Het
Pkhd1l1 T C 15: 44,445,330 (GRCm39) V3734A probably benign Het
Plcb1 T C 2: 135,177,396 (GRCm39) L576P probably damaging Het
Plxnc1 T A 10: 94,663,041 (GRCm39) N1203Y probably benign Het
Pramel16 T C 4: 143,677,327 (GRCm39) N84S probably benign Het
Prkn T G 17: 11,456,408 (GRCm39) S77R probably benign Het
Rev3l C T 10: 39,697,537 (GRCm39) S678L probably benign Het
Rims3 T C 4: 120,746,569 (GRCm39) Y197H probably damaging Het
S1pr4 A G 10: 81,335,267 (GRCm39) M69T probably benign Het
Sf3a1 T C 11: 4,129,420 (GRCm39) Y757H possibly damaging Het
Slc30a9 T A 5: 67,484,248 (GRCm39) N128K probably damaging Het
Slc35a4 T C 18: 36,815,980 (GRCm39) V270A possibly damaging Het
Speg A C 1: 75,364,480 (GRCm39) D287A possibly damaging Het
St18 T C 1: 6,873,216 (GRCm39) V317A probably benign Het
Stk11 G T 10: 79,963,867 (GRCm39) E350D probably benign Het
Strn3 A G 12: 51,694,890 (GRCm39) L291S probably damaging Het
Susd1 C T 4: 59,315,773 (GRCm39) V733I probably benign Het
Tep1 T C 14: 51,105,502 (GRCm39) R173G probably benign Het
Tmem115 T C 9: 107,411,745 (GRCm39) V23A possibly damaging Het
Top2b A G 14: 16,386,123 (GRCm38) N110D possibly damaging Het
Wfikkn2 C T 11: 94,129,890 (GRCm39) V84M probably damaging Het
Other mutations in Ednrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Ednrb APN 14 104,057,455 (GRCm39) missense probably damaging 1.00
IGL01433:Ednrb APN 14 104,080,626 (GRCm39) missense probably damaging 0.98
IGL01631:Ednrb APN 14 104,080,661 (GRCm39) missense probably benign 0.02
IGL01696:Ednrb APN 14 104,060,625 (GRCm39) missense probably benign 0.00
IGL01974:Ednrb APN 14 104,058,254 (GRCm39) missense probably damaging 1.00
IGL02749:Ednrb APN 14 104,060,495 (GRCm39) missense possibly damaging 0.63
IGL03277:Ednrb APN 14 104,080,735 (GRCm39) missense probably benign 0.00
gus-gus UTSW 14 104,057,449 (GRCm39) missense probably damaging 1.00
pongo UTSW 14 104,060,710 (GRCm39) splice site probably null
sposh UTSW 14 104,059,150 (GRCm39) missense probably damaging 0.97
R0284:Ednrb UTSW 14 104,057,449 (GRCm39) missense probably damaging 1.00
R0591:Ednrb UTSW 14 104,060,710 (GRCm39) splice site probably null
R2072:Ednrb UTSW 14 104,054,535 (GRCm39) missense probably benign 0.27
R2080:Ednrb UTSW 14 104,080,536 (GRCm39) missense probably damaging 1.00
R2102:Ednrb UTSW 14 104,058,350 (GRCm39) nonsense probably null
R2118:Ednrb UTSW 14 104,059,204 (GRCm39) missense probably benign 0.42
R2119:Ednrb UTSW 14 104,059,204 (GRCm39) missense probably benign 0.42
R2124:Ednrb UTSW 14 104,059,204 (GRCm39) missense probably benign 0.42
R2851:Ednrb UTSW 14 104,059,110 (GRCm39) missense probably benign 0.04
R2852:Ednrb UTSW 14 104,059,110 (GRCm39) missense probably benign 0.04
R3708:Ednrb UTSW 14 104,054,516 (GRCm39) missense probably damaging 1.00
R4887:Ednrb UTSW 14 104,057,447 (GRCm39) missense possibly damaging 0.95
R5626:Ednrb UTSW 14 104,080,564 (GRCm39) missense probably damaging 0.98
R5688:Ednrb UTSW 14 104,060,831 (GRCm39) missense probably damaging 1.00
R5802:Ednrb UTSW 14 104,059,150 (GRCm39) missense probably damaging 0.97
R5834:Ednrb UTSW 14 104,058,313 (GRCm39) missense probably damaging 1.00
R7212:Ednrb UTSW 14 104,080,444 (GRCm39) missense probably damaging 0.96
R7368:Ednrb UTSW 14 104,057,453 (GRCm39) missense probably benign 0.01
R7766:Ednrb UTSW 14 104,080,725 (GRCm39) missense probably benign 0.12
R7866:Ednrb UTSW 14 104,080,738 (GRCm39) missense probably benign
R8170:Ednrb UTSW 14 104,060,640 (GRCm39) missense possibly damaging 0.92
R8220:Ednrb UTSW 14 104,059,141 (GRCm39) missense probably damaging 1.00
R8375:Ednrb UTSW 14 104,057,383 (GRCm39) missense probably damaging 1.00
R8431:Ednrb UTSW 14 104,080,633 (GRCm39) missense probably benign 0.00
R9035:Ednrb UTSW 14 104,080,665 (GRCm39) missense probably benign 0.00
R9128:Ednrb UTSW 14 104,080,528 (GRCm39) missense probably damaging 1.00
R9546:Ednrb UTSW 14 104,080,459 (GRCm39) missense probably benign
R9547:Ednrb UTSW 14 104,080,459 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCTAGCAGGTAGAGCTTGG -3'
(R):5'- GATTGTGCCACTGTCTGCAC -3'

Sequencing Primer
(F):5'- AGCTTGGTTGTATTGAATTGCAAAG -3'
(R):5'- CAAAGGGCAGTTCTTCCT -3'
Posted On 2020-07-28