Incidental Mutation 'R8299:Csf2rb'
ID 639158
Institutional Source Beutler Lab
Gene Symbol Csf2rb
Ensembl Gene ENSMUSG00000071713
Gene Name colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
Synonyms Csf2rb1, AIC2B, Il5rb, Bc, Il3rb1, beta c, Il3r, common beta chain, CDw131
MMRRC Submission
Accession Numbers

Genbank: NM_007780; MGI: 1339759

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8299 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 78325752-78353847 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 78346469 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 471 (Y471N)
Ref Sequence ENSEMBL: ENSMUSP00000094082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096355]
AlphaFold P26955
Predicted Effect possibly damaging
Transcript: ENSMUST00000096355
AA Change: Y471N

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000094082
Gene: ENSMUSG00000071713
AA Change: Y471N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCOP:d1gh7a1 29 130 6e-58 SMART
FN3 136 224 4.44e0 SMART
Blast:FN3 245 338 3e-24 BLAST
SCOP:d1gh7a3 245 338 2e-45 SMART
FN3 343 426 2.41e0 SMART
transmembrane domain 446 468 N/A INTRINSIC
low complexity region 716 743 N/A INTRINSIC
low complexity region 824 845 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit lung pathology including lymphocytic infiltration, alveolar proteinosis-like areas, and increased saturated phosphatidylcholine pool sizes. Mutants also have low peripheral eosinophil numbers. [provided by MGI curators]
Allele List at MGI

 All alleles(7) : Targeted, knock-out(3) Targeted, other(4)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 C A 10: 69,976,151 P1216Q probably damaging Het
Aspscr1 T C 11: 120,709,074 Y164H Het
Atp13a3 A C 16: 30,333,801 F1021C probably damaging Het
Bcl9 T C 3: 97,205,536 D1201G probably damaging Het
Bora G A 14: 99,068,134 R313Q probably benign Het
Cdh19 A G 1: 110,919,548 Y444H probably benign Het
Cep70 A T 9: 99,262,861 M87L possibly damaging Het
Clstn3 A G 6: 124,437,373 probably null Het
Cntnap4 G A 8: 112,773,692 G539S probably damaging Het
Dctn4 T A 18: 60,545,800 I197N probably benign Het
Ednrb A G 14: 103,823,500 L163P probably damaging Het
Elovl2 T C 13: 41,191,920 N101D probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Etl4 T A 2: 20,744,063 I404K possibly damaging Het
Gadd45a A G 6: 67,037,199 probably null Het
Gfod2 T C 8: 105,728,162 T29A probably benign Het
Hltf A G 3: 20,082,822 K408E possibly damaging Het
Inf2 A G 12: 112,604,112 T362A probably benign Het
Klhl12 G A 1: 134,488,940 G467R probably damaging Het
Lrrk2 A T 15: 91,673,240 probably benign Het
Mcee G A 7: 64,411,873 E29K unknown Het
Mki67 A T 7: 135,704,620 I571N probably damaging Het
Morc3 T C 16: 93,853,200 Y290H probably damaging Het
Muc4 A G 16: 32,755,897 T1924A unknown Het
Myh14 T A 7: 44,627,048 D1170V probably damaging Het
Olfr121 G T 17: 37,752,000 E49* probably null Het
Olfr544 T C 7: 102,484,202 H306R probably benign Het
Olfr575 T C 7: 102,955,532 E30G probably damaging Het
Olfr798 T C 10: 129,625,960 I34V probably benign Het
Park2 T G 17: 11,237,521 S77R probably benign Het
Pcdhb17 T C 18: 37,485,355 I66T probably damaging Het
Pkhd1l1 T C 15: 44,581,934 V3734A probably benign Het
Plcb1 T C 2: 135,335,476 L576P probably damaging Het
Plxnc1 T A 10: 94,827,179 N1203Y probably benign Het
Pramef25 T C 4: 143,950,757 N84S probably benign Het
Rev3l C T 10: 39,821,541 S678L probably benign Het
Rims3 T C 4: 120,889,372 Y197H probably damaging Het
S1pr4 A G 10: 81,499,433 M69T probably benign Het
Sf3a1 T C 11: 4,179,420 Y757H possibly damaging Het
Slc30a9 T A 5: 67,326,905 N128K probably damaging Het
Slc35a4 T C 18: 36,682,927 V270A possibly damaging Het
Soga1 T G 2: 157,020,731 E1426A possibly damaging Het
Speg A C 1: 75,387,836 D287A possibly damaging Het
St18 T C 1: 6,802,992 V317A probably benign Het
Stk11 G T 10: 80,128,033 E350D probably benign Het
Strn3 A G 12: 51,648,107 L291S probably damaging Het
Susd1 C T 4: 59,315,773 V733I probably benign Het
Tep1 T C 14: 50,868,045 R173G probably benign Het
Tmem115 T C 9: 107,534,546 V23A possibly damaging Het
Top2b A G 14: 16,386,123 N110D possibly damaging Het
Wfikkn2 C T 11: 94,239,064 V84M probably damaging Het
Other mutations in Csf2rb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Csf2rb APN 15 78348514 nonsense probably null
IGL00979:Csf2rb APN 15 78348104 missense probably damaging 1.00
IGL01613:Csf2rb APN 15 78335302 intron probably benign
IGL01724:Csf2rb APN 15 78336414 missense probably damaging 1.00
IGL01942:Csf2rb APN 15 78340492 missense probably benign
IGL02479:Csf2rb APN 15 78341724 nonsense probably null
3-1:Csf2rb UTSW 15 78344603 missense probably damaging 1.00
IGL02802:Csf2rb UTSW 15 78338903 missense probably benign 0.00
R0133:Csf2rb UTSW 15 78339004 unclassified probably benign
R0179:Csf2rb UTSW 15 78336372 missense possibly damaging 0.52
R0487:Csf2rb UTSW 15 78348331 missense probably benign 0.00
R1544:Csf2rb UTSW 15 78340755 missense probably benign 0.02
R1619:Csf2rb UTSW 15 78335211 missense probably damaging 0.99
R1690:Csf2rb UTSW 15 78348644 missense probably benign 0.11
R1831:Csf2rb UTSW 15 78348253 missense probably benign 0.03
R3970:Csf2rb UTSW 15 78341467 missense probably benign
R4922:Csf2rb UTSW 15 78346467 missense probably benign 0.02
R5151:Csf2rb UTSW 15 78340581 missense probably damaging 1.00
R5202:Csf2rb UTSW 15 78349057 missense possibly damaging 0.51
R5398:Csf2rb UTSW 15 78348620 missense probably benign
R5496:Csf2rb UTSW 15 78340561 missense probably damaging 1.00
R5786:Csf2rb UTSW 15 78348955 missense probably damaging 1.00
R6166:Csf2rb UTSW 15 78344566 missense probably damaging 1.00
R6347:Csf2rb UTSW 15 78345552 missense probably damaging 0.99
R6350:Csf2rb UTSW 15 78345552 missense probably damaging 0.99
R6899:Csf2rb UTSW 15 78340702 missense probably benign 0.01
R6984:Csf2rb UTSW 15 78345519 missense probably damaging 1.00
R7484:Csf2rb UTSW 15 78338899 missense possibly damaging 0.53
R7671:Csf2rb UTSW 15 78338930 missense probably damaging 1.00
R7751:Csf2rb UTSW 15 78341639 missense probably damaging 1.00
R7781:Csf2rb UTSW 15 78344571 missense probably benign 0.00
R7861:Csf2rb UTSW 15 78349157 missense probably damaging 1.00
R8135:Csf2rb UTSW 15 78348119 missense possibly damaging 0.95
R8154:Csf2rb UTSW 15 78340442 critical splice acceptor site probably null
R8315:Csf2rb UTSW 15 78347381 missense possibly damaging 0.83
R8926:Csf2rb UTSW 15 78340549 missense probably benign
R8948:Csf2rb UTSW 15 78348320 missense probably benign 0.05
R8950:Csf2rb UTSW 15 78348320 missense probably benign 0.05
R9265:Csf2rb UTSW 15 78348546 missense probably benign 0.08
X0024:Csf2rb UTSW 15 78336360 missense probably damaging 1.00
X0028:Csf2rb UTSW 15 78349002 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCATATTGAAGACAGGGAGC -3'
(R):5'- GATTCCATAGACCTCTGTGCC -3'

Sequencing Primer
(F):5'- TGGCCTTTCTCACAGAGGG -3'
(R):5'- ATAGACCTCTGTGCCAGCTAC -3'
Posted On 2020-07-28