Mutagenetix > Incidental Mutation

Incidental Mutation 'R0703:Polr3a'

63917

Institutional Source

Beutler Lab

Gene Symbol

Polr3a

Ensembl Gene

ENSMUSG00000025280

Gene Name

polymerase (RNA) III (DNA directed) polypeptide A

Synonyms

RPC1, 9330175N20Rik, RPC155

MMRRC Submission

038886-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0703 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

24448696-24487058 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 24484164 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 91 (P91L)

Ref Sequence

ENSEMBL: ENSMUSP00000153243 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]

AlphaFold

B2RXC6

Predicted Effect

probably damaging
Transcript: ENSMUST00000026322
AA Change: P91L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: P91L

Domain	Start	End	E-Value	Type
Blast:RPOLA_N	122	218	5e-43	BLAST
RPOLA_N	248	553	1.09e-176	SMART
Pfam:RNA_pol_Rpb1_4	728	834	4e-35	PFAM
Pfam:RNA_pol_Rpb1_5	841	1318	1.2e-92	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000223718
AA Change: P91L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223931

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225014

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225526

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 9 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts6	C	T	13: 104,352,847	H403Y	probably damaging	Het
Cfap70	T	A	14: 20,439,715	I248F	probably damaging	Het
Gpam	A	G	19: 55,072,756	Y775H	probably benign	Het
Hpgd	T	C	8: 56,295,039	V65A	probably damaging	Het
Lair1	A	T	7: 4,010,760	C163S	probably null	Het
Ldhb	C	T	6: 142,495,601	G188R	probably damaging	Het
Serpinb9b	C	A	13: 33,032,981	N78K	probably benign	Het
Socs4	C	T	14: 47,290,048	H147Y	probably damaging	Het
Utp23	TGAGGAGGAGGAGGAGGA	TGAGGAGGAGGAGGA	15: 51,882,356		probably benign	Het

Other mutations in Polr3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Polr3a	APN	14	24475863	missense	probably benign	0.35
IGL00974:Polr3a	APN	14	24479424	missense	probably benign	0.05
IGL01348:Polr3a	APN	14	24461763	missense	probably damaging	1.00
IGL01464:Polr3a	APN	14	24470681	splice site	probably benign
IGL01785:Polr3a	APN	14	24484120	nonsense	probably null
IGL01786:Polr3a	APN	14	24484120	nonsense	probably null
IGL01936:Polr3a	APN	14	24479188	missense	probably damaging	1.00
IGL02095:Polr3a	APN	14	24454610	missense	possibly damaging	0.91
IGL02454:Polr3a	APN	14	24475823	missense	possibly damaging	0.87
IGL02702:Polr3a	APN	14	24470877	missense	probably benign	0.07
IGL02961:Polr3a	APN	14	24467040	nonsense	probably null
IGL03069:Polr3a	APN	14	24461740	missense	probably damaging	0.99
R0001:Polr3a	UTSW	14	24452189	splice site	probably benign
R0048:Polr3a	UTSW	14	24469255	splice site	probably benign
R0157:Polr3a	UTSW	14	24479186	missense	probably damaging	0.99
R0445:Polr3a	UTSW	14	24454921	missense	probably benign	0.00
R0449:Polr3a	UTSW	14	24484466	missense	probably damaging	0.99
R0597:Polr3a	UTSW	14	24484134	missense	probably benign	0.29
R0604:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0644:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0754:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0767:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0816:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0817:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0819:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0840:Polr3a	UTSW	14	24452200	missense	possibly damaging	0.95
R1481:Polr3a	UTSW	14	24452548	missense	probably null	0.98
R1644:Polr3a	UTSW	14	24470624	missense	probably damaging	1.00
R1699:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R1704:Polr3a	UTSW	14	24484120	nonsense	probably null
R2363:Polr3a	UTSW	14	24475892	splice site	probably null
R3419:Polr3a	UTSW	14	24467035	missense	probably damaging	1.00
R3934:Polr3a	UTSW	14	24476101	missense	probably benign	0.30
R4296:Polr3a	UTSW	14	24453196	missense	possibly damaging	0.82
R4611:Polr3a	UTSW	14	24452508	splice site	probably null
R4690:Polr3a	UTSW	14	24464281	missense	possibly damaging	0.78
R4934:Polr3a	UTSW	14	24452624	missense	probably benign	0.11
R4947:Polr3a	UTSW	14	24482464	missense	probably benign	0.00
R5232:Polr3a	UTSW	14	24453211	missense	probably benign	0.00
R5263:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5264:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5265:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5282:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5319:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5321:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5323:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5387:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5388:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5401:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5402:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5443:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5444:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5725:Polr3a	UTSW	14	24465387	splice site	probably null
R5841:Polr3a	UTSW	14	24450698	missense	probably benign	0.00
R6408:Polr3a	UTSW	14	24486871	critical splice donor site	probably null
R6704:Polr3a	UTSW	14	24461842	missense	probably damaging	1.00
R7136:Polr3a	UTSW	14	24461815	missense	probably damaging	1.00
R7307:Polr3a	UTSW	14	24459987	missense	probably benign	0.03
R7368:Polr3a	UTSW	14	24467076	missense	probably damaging	0.98
R7800:Polr3a	UTSW	14	24484387	missense	probably null	0.83
R8753:Polr3a	UTSW	14	24463634	nonsense	probably null
R8785:Polr3a	UTSW	14	24452315	missense	probably benign	0.06
R8848:Polr3a	UTSW	14	24450766	missense	probably damaging	1.00
R9025:Polr3a	UTSW	14	24469411	missense	probably damaging	1.00
R9139:Polr3a	UTSW	14	24469348	missense	probably damaging	1.00
R9264:Polr3a	UTSW	14	24470831	missense	probably benign
R9309:Polr3a	UTSW	14	24459999	missense	probably benign
R9363:Polr3a	UTSW	14	24450763	missense	probably damaging	1.00
R9526:Polr3a	UTSW	14	24453245	missense	probably benign	0.00
R9585:Polr3a	UTSW	14	24452221	missense	probably damaging	1.00
Z1088:Polr3a	UTSW	14	24479724	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GCACGGCTTGCGATGAATAAACTAC -3'
(R):5'- TCCCAGTGTTCCACAGTTGACACG -3'

Sequencing Primer
(F):5'- agcaccaaacgccttacc -3'
(R):5'- ACGTGAAATCGTTGGTCCC -3'

Posted On

2013-07-30