Incidental Mutation 'R8300:Tmem57'
ID639190
Institutional Source Beutler Lab
Gene Symbol Tmem57
Ensembl Gene ENSMUSG00000028826
Gene Nametransmembrane protein 57
Synonyms1110007C24Rik, C61, 9230118A01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.695) question?
Stock #R8300 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location134802759-134853345 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134828451 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 237 (I237T)
Ref Sequence ENSEMBL: ENSMUSP00000030628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030628] [ENSMUST00000137707] [ENSMUST00000148595]
Predicted Effect probably benign
Transcript: ENSMUST00000030628
AA Change: I237T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030628
Gene: ENSMUSG00000028826
AA Change: I237T

DomainStartEndE-ValueType
Pfam:Macoilin 2 662 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137707
SMART Domains Protein: ENSMUSP00000124477
Gene: ENSMUSG00000028826

DomainStartEndE-ValueType
Pfam:Macoilin 2 157 2.1e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148595
SMART Domains Protein: ENSMUSP00000125440
Gene: ENSMUSG00000028826

DomainStartEndE-ValueType
Pfam:Macoilin 2 78 7e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik A T 2: 28,462,423 Y109* probably null Het
1700024P16Rik A T 4: 105,000,492 K622M probably damaging Het
6430531B16Rik A T 7: 139,977,178 I98N probably damaging Het
AB124611 A G 9: 21,526,265 M1V probably null Het
Abca12 T A 1: 71,313,964 N773I possibly damaging Het
Adh7 A G 3: 138,224,064 E167G probably damaging Het
Ank2 T A 3: 127,010,906 D622V Het
Asf1b T A 8: 83,969,176 F149I possibly damaging Het
Bach1 T C 16: 87,719,108 V179A probably benign Het
C1ra C T 6: 124,521,638 A430V probably benign Het
Cacna1c T A 6: 118,598,756 Q1944L Het
Camkk1 T C 11: 73,027,440 V158A probably benign Het
Ccdc152 T C 15: 3,298,152 T48A probably benign Het
Cd180 A T 13: 102,704,793 M116L probably benign Het
Clca2 C T 3: 145,098,931 G12R probably benign Het
Coq8b T C 7: 27,242,246 V252A possibly damaging Het
Cp A G 3: 19,957,221 probably benign Het
Ctsj A T 13: 61,002,471 V238E probably damaging Het
Ctsj C T 13: 61,002,472 V238I probably damaging Het
Cxcr2 A T 1: 74,159,174 M276L probably benign Het
Drd5 T C 5: 38,320,329 S222P probably damaging Het
Egflam T C 15: 7,254,451 D269G possibly damaging Het
Fbn2 C T 18: 58,209,615 R64Q probably benign Het
Gm10220 T C 5: 26,117,820 E198G probably damaging Het
Gm1527 A T 3: 28,926,595 N615Y possibly damaging Het
Gpatch3 A G 4: 133,579,829 H308R probably damaging Het
Gsdmc4 A G 15: 63,894,941 I261T probably damaging Het
Gsg1 T G 6: 135,237,582 T310P probably benign Het
Hecw2 T C 1: 53,887,616 S1075G probably null Het
Hyal6 A G 6: 24,734,088 T7A probably benign Het
Ighv1-59 T G 12: 115,335,367 Q22H probably damaging Het
Lyst T A 13: 13,664,058 M1853K possibly damaging Het
Mccc1 A T 3: 35,963,604 M649K probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nek4 A G 14: 30,970,395 D399G Het
Obscn T C 11: 59,043,070 K5323E probably benign Het
Olfr414 T A 1: 174,430,534 Y35* probably null Het
Paics T C 5: 76,961,406 V196A probably damaging Het
Pced1a C A 2: 130,424,237 probably benign Het
Pik3cb A G 9: 99,046,658 V848A probably damaging Het
Ppm1h T A 10: 122,782,213 N92K probably damaging Het
Ppp1r16b T A 2: 158,746,651 I152N probably damaging Het
Pramel7 A G 2: 87,489,623 M442T probably benign Het
Prex2 A T 1: 11,231,718 N1415I possibly damaging Het
Pum3 T C 19: 27,422,373 K220R probably benign Het
Qrich2 G T 11: 116,456,349 D1216E probably benign Het
Rbbp8 T A 18: 11,705,776 silent Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rimbp2 C T 5: 128,797,771 R252Q probably damaging Het
Rnpep T C 1: 135,283,659 H117R probably benign Het
Serpinb10 A G 1: 107,546,726 D206G probably benign Het
Sh3tc1 C T 5: 35,697,448 V1302M probably benign Het
Slmap T C 14: 26,418,219 E780G possibly damaging Het
Snrpg T A 6: 86,376,576 V46E probably damaging Het
Sptbn5 T A 2: 120,047,577 Q953L noncoding transcript Het
Stard9 C T 2: 120,704,769 L3836F possibly damaging Het
Tcerg1 T A 18: 42,550,072 M619K probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tnfrsf9 C T 4: 150,933,099 T137M probably damaging Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trak1 G T 9: 121,460,499 E626* probably null Het
Trio G T 15: 27,855,022 H750Q possibly damaging Het
U2af2 T C 7: 5,067,415 probably benign Het
Vmn2r3 T C 3: 64,274,926 I451V probably benign Het
Zfp930 A T 8: 69,228,346 N230I probably benign Het
Other mutations in Tmem57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Tmem57 APN 4 134828206 missense probably damaging 0.96
IGL01062:Tmem57 APN 4 134833297 missense probably damaging 0.97
IGL02249:Tmem57 APN 4 134828312 missense possibly damaging 0.50
IGL02850:Tmem57 APN 4 134828386 missense probably benign 0.12
subtle UTSW 4 134828299 missense probably damaging 1.00
R0400:Tmem57 UTSW 4 134828116 missense probably benign 0.25
R0548:Tmem57 UTSW 4 134806660 missense probably damaging 1.00
R0589:Tmem57 UTSW 4 134828217 missense probably benign 0.30
R1536:Tmem57 UTSW 4 134804507 missense probably damaging 1.00
R2063:Tmem57 UTSW 4 134828279 missense possibly damaging 0.95
R2151:Tmem57 UTSW 4 134811223 missense probably benign 0.00
R2509:Tmem57 UTSW 4 134804388 missense probably damaging 1.00
R2510:Tmem57 UTSW 4 134804388 missense probably damaging 1.00
R2511:Tmem57 UTSW 4 134804388 missense probably damaging 1.00
R3806:Tmem57 UTSW 4 134830580 missense probably benign 0.00
R3946:Tmem57 UTSW 4 134804481 missense probably damaging 1.00
R4994:Tmem57 UTSW 4 134828299 missense probably damaging 1.00
R4999:Tmem57 UTSW 4 134828133 missense probably benign 0.23
R5169:Tmem57 UTSW 4 134828463 missense probably benign 0.23
R5310:Tmem57 UTSW 4 134837019 intron probably benign
R5443:Tmem57 UTSW 4 134833308 nonsense probably null
R5554:Tmem57 UTSW 4 134828134 missense probably benign
R5712:Tmem57 UTSW 4 134828058 missense probably benign 0.06
R6627:Tmem57 UTSW 4 134836343 missense probably damaging 0.98
R7100:Tmem57 UTSW 4 134806660 missense probably damaging 1.00
R7448:Tmem57 UTSW 4 134828279 missense possibly damaging 0.95
R8059:Tmem57 UTSW 4 134828048 nonsense probably null
X0062:Tmem57 UTSW 4 134836347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCAGTGCATGAGTCCTC -3'
(R):5'- TGTACTTACCACCGCTTCCAAG -3'

Sequencing Primer
(F):5'- AGCAGTGCATGAGTCCTCTTTTAAG -3'
(R):5'- GCTTCCAAGTTTCTACTGTGATCAG -3'
Posted On2020-07-28