Incidental Mutation 'R8300:Myl10'
ID639197
Institutional Source Beutler Lab
Gene Symbol Myl10
Ensembl Gene ENSMUSG00000005474
Gene Namemyosin, light chain 10, regulatory
SynonymsPLRLC-C, 1700027I08Rik, PLRLC, PLRLC-A, Mylc2pl, PLRLC-B
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8300 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location136693146-136701094 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 136697971 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 70 (V70L)
Ref Sequence ENSEMBL: ENSMUSP00000143165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005611] [ENSMUST00000196068] [ENSMUST00000196436] [ENSMUST00000197186]
Predicted Effect probably benign
Transcript: ENSMUST00000005611
AA Change: V86L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000005611
Gene: ENSMUSG00000005474
AA Change: V86L

DomainStartEndE-ValueType
EFh 9 37 1.5e-5 SMART
EFh 79 107 3.16e1 SMART
Blast:EFh 115 143 6e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000196068
AA Change: K115N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142570
Gene: ENSMUSG00000005474
AA Change: K115N

DomainStartEndE-ValueType
Pfam:EF-hand_1 9 37 9.4e-7 PFAM
Pfam:EF-hand_6 9 40 9.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196436
AA Change: V70L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142495
Gene: ENSMUSG00000005474
AA Change: V70L

DomainStartEndE-ValueType
Pfam:EF-hand_6 1 24 5.4e-3 PFAM
Pfam:EF-hand_8 5 39 1.3e-3 PFAM
Blast:EFh 63 91 1e-11 BLAST
Blast:EFh 99 127 4e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000197186
AA Change: V70L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143165
Gene: ENSMUSG00000005474
AA Change: V70L

DomainStartEndE-ValueType
Pfam:EF-hand_6 1 24 5.4e-3 PFAM
Pfam:EF-hand_8 5 39 1.3e-3 PFAM
Blast:EFh 63 91 1e-11 BLAST
Blast:EFh 99 127 4e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199074
Meta Mutation Damage Score 0.0667 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik A T 2: 28,462,423 Y109* probably null Het
1700024P16Rik A T 4: 105,000,492 K622M probably damaging Het
6430531B16Rik A T 7: 139,977,178 I98N probably damaging Het
AB124611 A G 9: 21,526,265 M1V probably null Het
Abca12 T A 1: 71,313,964 N773I possibly damaging Het
Adh7 A G 3: 138,224,064 E167G probably damaging Het
Ank2 T A 3: 127,010,906 D622V Het
Asf1b T A 8: 83,969,176 F149I possibly damaging Het
Bach1 T C 16: 87,719,108 V179A probably benign Het
C1ra C T 6: 124,521,638 A430V probably benign Het
Cacna1c T A 6: 118,598,756 Q1944L Het
Camkk1 T C 11: 73,027,440 V158A probably benign Het
Ccdc152 T C 15: 3,298,152 T48A probably benign Het
Cd180 A T 13: 102,704,793 M116L probably benign Het
Clca2 C T 3: 145,098,931 G12R probably benign Het
Coq8b T C 7: 27,242,246 V252A possibly damaging Het
Cp A G 3: 19,957,221 probably benign Het
Ctsj A T 13: 61,002,471 V238E probably damaging Het
Ctsj C T 13: 61,002,472 V238I probably damaging Het
Cxcr2 A T 1: 74,159,174 M276L probably benign Het
Drd5 T C 5: 38,320,329 S222P probably damaging Het
Egflam T C 15: 7,254,451 D269G possibly damaging Het
Fbn2 C T 18: 58,209,615 R64Q probably benign Het
Gm10220 T C 5: 26,117,820 E198G probably damaging Het
Gm1527 A T 3: 28,926,595 N615Y possibly damaging Het
Gpatch3 A G 4: 133,579,829 H308R probably damaging Het
Gsdmc4 A G 15: 63,894,941 I261T probably damaging Het
Gsg1 T G 6: 135,237,582 T310P probably benign Het
Hecw2 T C 1: 53,887,616 S1075G probably null Het
Hyal6 A G 6: 24,734,088 T7A probably benign Het
Ighv1-59 T G 12: 115,335,367 Q22H probably damaging Het
Lyst T A 13: 13,664,058 M1853K possibly damaging Het
Mccc1 A T 3: 35,963,604 M649K probably damaging Het
Nek4 A G 14: 30,970,395 D399G Het
Obscn T C 11: 59,043,070 K5323E probably benign Het
Olfr414 T A 1: 174,430,534 Y35* probably null Het
Paics T C 5: 76,961,406 V196A probably damaging Het
Pced1a C A 2: 130,424,237 probably benign Het
Pik3cb A G 9: 99,046,658 V848A probably damaging Het
Ppm1h T A 10: 122,782,213 N92K probably damaging Het
Ppp1r16b T A 2: 158,746,651 I152N probably damaging Het
Pramel7 A G 2: 87,489,623 M442T probably benign Het
Prex2 A T 1: 11,231,718 N1415I possibly damaging Het
Pum3 T C 19: 27,422,373 K220R probably benign Het
Qrich2 G T 11: 116,456,349 D1216E probably benign Het
Rbbp8 T A 18: 11,705,776 silent Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rimbp2 C T 5: 128,797,771 R252Q probably damaging Het
Rnpep T C 1: 135,283,659 H117R probably benign Het
Serpinb10 A G 1: 107,546,726 D206G probably benign Het
Sh3tc1 C T 5: 35,697,448 V1302M probably benign Het
Slmap T C 14: 26,418,219 E780G possibly damaging Het
Snrpg T A 6: 86,376,576 V46E probably damaging Het
Sptbn5 T A 2: 120,047,577 Q953L noncoding transcript Het
Stard9 C T 2: 120,704,769 L3836F possibly damaging Het
Tcerg1 T A 18: 42,550,072 M619K probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tmem57 A G 4: 134,828,451 I237T probably benign Het
Tnfrsf9 C T 4: 150,933,099 T137M probably damaging Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trak1 G T 9: 121,460,499 E626* probably null Het
Trio G T 15: 27,855,022 H750Q possibly damaging Het
U2af2 T C 7: 5,067,415 probably benign Het
Vmn2r3 T C 3: 64,274,926 I451V probably benign Het
Zfp930 A T 8: 69,228,346 N230I probably benign Het
Other mutations in Myl10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03206:Myl10 APN 5 136697942 nonsense probably null
G1Funyon:Myl10 UTSW 5 136697971 missense probably benign 0.00
PIT4243001:Myl10 UTSW 5 136694293 missense probably benign 0.05
R4066:Myl10 UTSW 5 136695450 missense probably damaging 1.00
R5712:Myl10 UTSW 5 136694238 missense probably damaging 1.00
R6321:Myl10 UTSW 5 136697971 missense probably benign 0.00
R6322:Myl10 UTSW 5 136697971 missense probably benign 0.00
R6566:Myl10 UTSW 5 136697971 missense probably benign 0.00
R6756:Myl10 UTSW 5 136697971 missense probably benign 0.00
R6757:Myl10 UTSW 5 136697971 missense probably benign 0.00
R6894:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7033:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7152:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7242:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7411:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7484:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7535:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7537:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7630:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7631:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7635:Myl10 UTSW 5 136700864 missense probably benign 0.00
R7764:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7829:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7969:Myl10 UTSW 5 136700853 critical splice acceptor site probably null
R8065:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8066:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8067:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8202:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8203:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8204:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8206:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8217:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8248:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8301:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8343:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8731:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8732:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8831:Myl10 UTSW 5 136697971 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGATGCAGCTGGAGTAGTTCC -3'
(R):5'- TATACCAGGAGGAACGGCTG -3'

Sequencing Primer
(F):5'- CTGCCTAGAATCTTCCAGTGAGG -3'
(R):5'- CAGGAGGAACGGCTGGTTTG -3'
Posted On2020-07-28