Incidental Mutation 'R0703:Gpam'
ID63921
Institutional Source Beutler Lab
Gene Symbol Gpam
Ensembl Gene ENSMUSG00000024978
Gene Nameglycerol-3-phosphate acyltransferase, mitochondrial
SynonymsGPAT1
MMRRC Submission 038886-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R0703 (G1)
Quality Score139
Status Not validated
Chromosome19
Chromosomal Location55069734-55099451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55072756 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 775 (Y775H)
Ref Sequence ENSEMBL: ENSMUSP00000057635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061856]
Predicted Effect probably benign
Transcript: ENSMUST00000061856
AA Change: Y775H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000057635
Gene: ENSMUSG00000024978
AA Change: Y775H

DomainStartEndE-ValueType
Blast:PlsC 5 34 3e-8 BLAST
PlsC 224 357 2.46e-23 SMART
Blast:PlsC 499 551 8e-27 BLAST
low complexity region 687 699 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial enzyme which prefers saturated fatty acids as its substrate for the synthesis of glycerolipids. This metabolic pathway's first step is catalyzed by the encoded enzyme. Two forms for this enzyme exist, one in the mitochondria and one in the endoplasmic reticulum. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutant mice weighed less than controls and showed reduced triacylglycerol levels in the liver and plasma. The glycerolipid fatty acid composition is also disrupted in mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 9 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 C T 13: 104,352,847 H403Y probably damaging Het
Cfap70 T A 14: 20,439,715 I248F probably damaging Het
Hpgd T C 8: 56,295,039 V65A probably damaging Het
Lair1 A T 7: 4,010,760 C163S probably null Het
Ldhb C T 6: 142,495,601 G188R probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Serpinb9b C A 13: 33,032,981 N78K probably benign Het
Socs4 C T 14: 47,290,048 H147Y probably damaging Het
Utp23 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 15: 51,882,356 probably benign Het
Other mutations in Gpam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Gpam APN 19 55078332 missense possibly damaging 0.71
IGL01349:Gpam APN 19 55096119 critical splice donor site probably null
IGL01515:Gpam APN 19 55087451 missense probably damaging 1.00
IGL01650:Gpam APN 19 55081700 missense probably benign 0.02
IGL01768:Gpam APN 19 55087520 missense probably benign 0.00
IGL01809:Gpam APN 19 55075625 nonsense probably null
IGL01878:Gpam APN 19 55083374 missense probably benign 0.22
IGL02451:Gpam APN 19 55088203 missense probably damaging 1.00
IGL03293:Gpam APN 19 55071016 missense probably benign
IGL03391:Gpam APN 19 55081696 missense probably damaging 1.00
R0492:Gpam UTSW 19 55096179 missense possibly damaging 0.72
R1083:Gpam UTSW 19 55088211 splice site probably benign
R1432:Gpam UTSW 19 55079261 missense probably damaging 0.99
R1457:Gpam UTSW 19 55088176 missense probably damaging 1.00
R1556:Gpam UTSW 19 55076331 missense possibly damaging 0.94
R1733:Gpam UTSW 19 55081469 missense probably damaging 0.99
R1744:Gpam UTSW 19 55074591 missense probably damaging 1.00
R1776:Gpam UTSW 19 55078575 missense possibly damaging 0.88
R2267:Gpam UTSW 19 55072710 critical splice donor site probably null
R2697:Gpam UTSW 19 55083209 missense probably damaging 1.00
R3836:Gpam UTSW 19 55080458 missense probably benign
R3837:Gpam UTSW 19 55080458 missense probably benign
R3838:Gpam UTSW 19 55080458 missense probably benign
R3839:Gpam UTSW 19 55080458 missense probably benign
R4670:Gpam UTSW 19 55096119 critical splice donor site probably null
R4717:Gpam UTSW 19 55075614 missense probably benign 0.00
R4819:Gpam UTSW 19 55078341 missense probably benign 0.03
R5104:Gpam UTSW 19 55093986 missense probably benign 0.44
R5146:Gpam UTSW 19 55093946 missense probably damaging 1.00
R5183:Gpam UTSW 19 55083227 missense probably damaging 1.00
R5326:Gpam UTSW 19 55091165 missense probably benign 0.05
R5347:Gpam UTSW 19 55088837 missense probably damaging 1.00
R5621:Gpam UTSW 19 55079260 missense probably damaging 1.00
R5644:Gpam UTSW 19 55088899 missense probably benign 0.00
R6244:Gpam UTSW 19 55070985 missense probably damaging 1.00
R6260:Gpam UTSW 19 55083406 missense probably benign 0.40
R6965:Gpam UTSW 19 55074609 missense probably damaging 1.00
R7125:Gpam UTSW 19 55076335 missense probably benign
R7567:Gpam UTSW 19 55081630 missense possibly damaging 0.86
R7715:Gpam UTSW 19 55088921 missense probably benign 0.19
R7719:Gpam UTSW 19 55081670 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAAACTGCTTCTTCTTGACACC -3'
(R):5'- ACAAGACTGCAAGATGGATGCTTGG -3'

Sequencing Primer
(F):5'- TTCTTGACACCCCCCCAAC -3'
(R):5'- GCTTTCTTTAATAGATGGCAGGATAG -3'
Posted On2013-07-30