Incidental Mutation 'R8300:Trak1'
ID639210
Institutional Source Beutler Lab
Gene Symbol Trak1
Ensembl Gene ENSMUSG00000032536
Gene Nametrafficking protein, kinesin binding 1
Synonymshyrt, 2310001H13Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.368) question?
Stock #R8300 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location121297502-121474918 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 121460499 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 626 (E626*)
Ref Sequence ENSEMBL: ENSMUSP00000044482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045903] [ENSMUST00000210798] [ENSMUST00000211187] [ENSMUST00000211301] [ENSMUST00000211439]
Predicted Effect probably null
Transcript: ENSMUST00000045903
AA Change: E626*
SMART Domains Protein: ENSMUSP00000044482
Gene: ENSMUSG00000032536
AA Change: E626*

DomainStartEndE-ValueType
Pfam:HAP1_N 47 352 8.1e-139 PFAM
Pfam:Milton 411 580 5e-72 PFAM
low complexity region 882 897 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000209446
AA Change: E147*
Predicted Effect probably null
Transcript: ENSMUST00000210798
AA Change: E523*
Predicted Effect probably null
Transcript: ENSMUST00000211187
AA Change: E616*
Predicted Effect probably null
Transcript: ENSMUST00000211301
AA Change: E523*
Predicted Effect probably benign
Transcript: ENSMUST00000211439
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice with a spontaneous mutation in this allele have various behavioral abnormalities consistent with hypertonia. Inclusions can be found in neuronal processes of the gray matter of the brainstem and spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik A T 2: 28,462,423 Y109* probably null Het
1700024P16Rik A T 4: 105,000,492 K622M probably damaging Het
6430531B16Rik A T 7: 139,977,178 I98N probably damaging Het
AB124611 A G 9: 21,526,265 M1V probably null Het
Abca12 T A 1: 71,313,964 N773I possibly damaging Het
Adh7 A G 3: 138,224,064 E167G probably damaging Het
Ank2 T A 3: 127,010,906 D622V Het
Asf1b T A 8: 83,969,176 F149I possibly damaging Het
Bach1 T C 16: 87,719,108 V179A probably benign Het
C1ra C T 6: 124,521,638 A430V probably benign Het
Cacna1c T A 6: 118,598,756 Q1944L Het
Camkk1 T C 11: 73,027,440 V158A probably benign Het
Ccdc152 T C 15: 3,298,152 T48A probably benign Het
Cd180 A T 13: 102,704,793 M116L probably benign Het
Clca2 C T 3: 145,098,931 G12R probably benign Het
Coq8b T C 7: 27,242,246 V252A possibly damaging Het
Cp A G 3: 19,957,221 probably benign Het
Ctsj A T 13: 61,002,471 V238E probably damaging Het
Ctsj C T 13: 61,002,472 V238I probably damaging Het
Cxcr2 A T 1: 74,159,174 M276L probably benign Het
Drd5 T C 5: 38,320,329 S222P probably damaging Het
Egflam T C 15: 7,254,451 D269G possibly damaging Het
Fbn2 C T 18: 58,209,615 R64Q probably benign Het
Gm10220 T C 5: 26,117,820 E198G probably damaging Het
Gm1527 A T 3: 28,926,595 N615Y possibly damaging Het
Gpatch3 A G 4: 133,579,829 H308R probably damaging Het
Gsdmc4 A G 15: 63,894,941 I261T probably damaging Het
Gsg1 T G 6: 135,237,582 T310P probably benign Het
Hecw2 T C 1: 53,887,616 S1075G probably null Het
Hyal6 A G 6: 24,734,088 T7A probably benign Het
Ighv1-59 T G 12: 115,335,367 Q22H probably damaging Het
Lyst T A 13: 13,664,058 M1853K possibly damaging Het
Mccc1 A T 3: 35,963,604 M649K probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nek4 A G 14: 30,970,395 D399G Het
Obscn T C 11: 59,043,070 K5323E probably benign Het
Olfr414 T A 1: 174,430,534 Y35* probably null Het
Paics T C 5: 76,961,406 V196A probably damaging Het
Pced1a C A 2: 130,424,237 probably benign Het
Pik3cb A G 9: 99,046,658 V848A probably damaging Het
Ppm1h T A 10: 122,782,213 N92K probably damaging Het
Ppp1r16b T A 2: 158,746,651 I152N probably damaging Het
Pramel7 A G 2: 87,489,623 M442T probably benign Het
Prex2 A T 1: 11,231,718 N1415I possibly damaging Het
Pum3 T C 19: 27,422,373 K220R probably benign Het
Qrich2 G T 11: 116,456,349 D1216E probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rimbp2 C T 5: 128,797,771 R252Q probably damaging Het
Rnpep T C 1: 135,283,659 H117R probably benign Het
Serpinb10 A G 1: 107,546,726 D206G probably benign Het
Sh3tc1 C T 5: 35,697,448 V1302M probably benign Het
Slmap T C 14: 26,418,219 E780G possibly damaging Het
Snrpg T A 6: 86,376,576 V46E probably damaging Het
Sptbn5 T A 2: 120,047,577 Q953L noncoding transcript Het
Stard9 C T 2: 120,704,769 L3836F possibly damaging Het
Tcerg1 T A 18: 42,550,072 M619K probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tmem57 A G 4: 134,828,451 I237T probably benign Het
Tnfrsf9 C T 4: 150,933,099 T137M probably damaging Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trio G T 15: 27,855,022 H750Q possibly damaging Het
Vmn2r3 T C 3: 64,274,926 I451V probably benign Het
Zfp930 A T 8: 69,228,346 N230I probably benign Het
Other mutations in Trak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Trak1 APN 9 121443736 critical splice donor site probably null
IGL01335:Trak1 APN 9 121454316 missense possibly damaging 0.58
IGL01777:Trak1 APN 9 121431560 splice site probably null
IGL01804:Trak1 APN 9 121442685 splice site probably benign
IGL01986:Trak1 APN 9 121472967 missense probably benign 0.00
IGL02248:Trak1 APN 9 121446794 missense probably damaging 1.00
IGL02276:Trak1 APN 9 121451668 missense probably damaging 1.00
IGL02556:Trak1 APN 9 121448901 missense probably damaging 1.00
IGL03368:Trak1 APN 9 121367122 missense possibly damaging 0.66
PIT4468001:Trak1 UTSW 9 121453332 missense probably benign 0.18
R0067:Trak1 UTSW 9 121472907 missense probably damaging 1.00
R0276:Trak1 UTSW 9 121454338 missense probably damaging 0.97
R0535:Trak1 UTSW 9 121443712 missense probably null 1.00
R0629:Trak1 UTSW 9 121367167 missense probably benign 0.37
R0671:Trak1 UTSW 9 121448955 critical splice donor site probably null
R0883:Trak1 UTSW 9 121453285 missense possibly damaging 0.90
R1160:Trak1 UTSW 9 121392007 missense probably benign 0.01
R1162:Trak1 UTSW 9 121453341 missense possibly damaging 0.93
R1168:Trak1 UTSW 9 121440679 missense probably damaging 1.00
R1398:Trak1 UTSW 9 121454359 missense probably damaging 1.00
R2118:Trak1 UTSW 9 121472997 makesense probably null
R2119:Trak1 UTSW 9 121472997 makesense probably null
R2120:Trak1 UTSW 9 121472997 makesense probably null
R2137:Trak1 UTSW 9 121472962 missense possibly damaging 0.83
R3162:Trak1 UTSW 9 121451734 splice site probably benign
R3888:Trak1 UTSW 9 121442797 splice site probably null
R3889:Trak1 UTSW 9 121445873 missense probably null 0.40
R4031:Trak1 UTSW 9 121451670 missense probably damaging 1.00
R4116:Trak1 UTSW 9 121448843 missense probably damaging 1.00
R4406:Trak1 UTSW 9 121431536 missense probably damaging 1.00
R4630:Trak1 UTSW 9 121454425 missense probably benign 0.02
R4631:Trak1 UTSW 9 121454425 missense probably benign 0.02
R4632:Trak1 UTSW 9 121454425 missense probably benign 0.02
R4786:Trak1 UTSW 9 121472494 missense probably benign 0.25
R5137:Trak1 UTSW 9 121367055 intron probably benign
R5159:Trak1 UTSW 9 121460412 missense probably damaging 0.99
R5467:Trak1 UTSW 9 121446798 missense probably damaging 1.00
R5661:Trak1 UTSW 9 121443637 missense possibly damaging 0.46
R5664:Trak1 UTSW 9 121472307 missense possibly damaging 0.47
R5769:Trak1 UTSW 9 121448838 missense probably damaging 1.00
R6041:Trak1 UTSW 9 121460412 missense probably damaging 0.99
R6257:Trak1 UTSW 9 121446755 missense probably damaging 1.00
R6257:Trak1 UTSW 9 121367224 missense possibly damaging 0.92
R6354:Trak1 UTSW 9 121451726 missense probably null 0.03
R6399:Trak1 UTSW 9 121453496 splice site probably null
R6513:Trak1 UTSW 9 121443756 missense probably benign
R6579:Trak1 UTSW 9 121443638 missense probably benign 0.29
R6940:Trak1 UTSW 9 121443718 missense possibly damaging 0.78
R7120:Trak1 UTSW 9 121460498 missense probably benign
R7299:Trak1 UTSW 9 121451863 splice site probably null
R7304:Trak1 UTSW 9 121416212 missense probably benign
R7396:Trak1 UTSW 9 121448907 missense possibly damaging 0.71
R7522:Trak1 UTSW 9 121442711 missense probably damaging 0.99
R7657:Trak1 UTSW 9 121472586 missense probably damaging 1.00
R7733:Trak1 UTSW 9 121367225 missense possibly damaging 0.92
R7793:Trak1 UTSW 9 121416198 nonsense probably null
R7999:Trak1 UTSW 9 121460425 missense probably damaging 1.00
R8209:Trak1 UTSW 9 121451727 missense probably benign
R8215:Trak1 UTSW 9 121469030 missense probably damaging 1.00
R8226:Trak1 UTSW 9 121451727 missense probably benign
R8261:Trak1 UTSW 9 121451667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGCCATGCTAACTCTCC -3'
(R):5'- TTTACAGGACTAATCGAGGCG -3'

Sequencing Primer
(F):5'- ATGCTAACTCTCCCTTCTCTTGG -3'
(R):5'- ACTAATCGAGGCGCCCTC -3'
Posted On2020-07-28