Incidental Mutation 'R8300:Egflam'
ID639223
Institutional Source Beutler Lab
Gene Symbol Egflam
Ensembl Gene ENSMUSG00000042961
Gene NameEGF-like, fibronectin type III and laminin G domains
Synonymsnectican, pikachurin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8300 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location7206120-7398395 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7254451 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 269 (D269G)
Ref Sequence ENSEMBL: ENSMUSP00000094238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058593] [ENSMUST00000096494] [ENSMUST00000160207]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058593
AA Change: D269G

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000055599
Gene: ENSMUSG00000042961
AA Change: D269G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FN3 35 123 4.52e-9 SMART
FN3 142 225 1.89e-11 SMART
low complexity region 256 273 N/A INTRINSIC
EGF_like 346 381 4.28e1 SMART
LamG 407 543 1.04e-34 SMART
EGF 563 602 3.48e-5 SMART
LamG 633 767 1.55e-33 SMART
EGF 787 820 4.35e-6 SMART
LamG 852 988 1.47e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000096494
AA Change: D269G

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000094238
Gene: ENSMUSG00000042961
AA Change: D269G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FN3 35 123 4.52e-9 SMART
FN3 142 225 1.89e-11 SMART
low complexity region 256 273 N/A INTRINSIC
EGF_like 346 381 4.28e1 SMART
LamG 407 543 1.04e-34 SMART
EGF 563 602 3.48e-5 SMART
LamG 633 767 1.55e-33 SMART
EGF 787 820 4.35e-6 SMART
LamG 860 996 1.47e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160207
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Homozygous null mutants are viable and fertile under normal conditions. They exhibit abnormal photoreceptor ribbon synapses, resulting in alteration in synaptic signal transmission and visual function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik A T 2: 28,462,423 Y109* probably null Het
1700024P16Rik A T 4: 105,000,492 K622M probably damaging Het
6430531B16Rik A T 7: 139,977,178 I98N probably damaging Het
AB124611 A G 9: 21,526,265 M1V probably null Het
Abca12 T A 1: 71,313,964 N773I possibly damaging Het
Adh7 A G 3: 138,224,064 E167G probably damaging Het
Ank2 T A 3: 127,010,906 D622V Het
Asf1b T A 8: 83,969,176 F149I possibly damaging Het
Bach1 T C 16: 87,719,108 V179A probably benign Het
C1ra C T 6: 124,521,638 A430V probably benign Het
Cacna1c T A 6: 118,598,756 Q1944L Het
Camkk1 T C 11: 73,027,440 V158A probably benign Het
Ccdc152 T C 15: 3,298,152 T48A probably benign Het
Cd180 A T 13: 102,704,793 M116L probably benign Het
Clca2 C T 3: 145,098,931 G12R probably benign Het
Coq8b T C 7: 27,242,246 V252A possibly damaging Het
Cp A G 3: 19,957,221 probably benign Het
Ctsj A T 13: 61,002,471 V238E probably damaging Het
Ctsj C T 13: 61,002,472 V238I probably damaging Het
Cxcr2 A T 1: 74,159,174 M276L probably benign Het
Drd5 T C 5: 38,320,329 S222P probably damaging Het
Fbn2 C T 18: 58,209,615 R64Q probably benign Het
Gm10220 T C 5: 26,117,820 E198G probably damaging Het
Gm1527 A T 3: 28,926,595 N615Y possibly damaging Het
Gpatch3 A G 4: 133,579,829 H308R probably damaging Het
Gsdmc4 A G 15: 63,894,941 I261T probably damaging Het
Gsg1 T G 6: 135,237,582 T310P probably benign Het
Hecw2 T C 1: 53,887,616 S1075G probably null Het
Hyal6 A G 6: 24,734,088 T7A probably benign Het
Ighv1-59 T G 12: 115,335,367 Q22H probably damaging Het
Lyst T A 13: 13,664,058 M1853K possibly damaging Het
Mccc1 A T 3: 35,963,604 M649K probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nek4 A G 14: 30,970,395 D399G Het
Obscn T C 11: 59,043,070 K5323E probably benign Het
Olfr414 T A 1: 174,430,534 Y35* probably null Het
Paics T C 5: 76,961,406 V196A probably damaging Het
Pced1a C A 2: 130,424,237 probably benign Het
Pik3cb A G 9: 99,046,658 V848A probably damaging Het
Ppm1h T A 10: 122,782,213 N92K probably damaging Het
Ppp1r16b T A 2: 158,746,651 I152N probably damaging Het
Pramel7 A G 2: 87,489,623 M442T probably benign Het
Prex2 A T 1: 11,231,718 N1415I possibly damaging Het
Pum3 T C 19: 27,422,373 K220R probably benign Het
Qrich2 G T 11: 116,456,349 D1216E probably benign Het
Rbbp8 T A 18: 11,705,776 silent Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rimbp2 C T 5: 128,797,771 R252Q probably damaging Het
Rnpep T C 1: 135,283,659 H117R probably benign Het
Serpinb10 A G 1: 107,546,726 D206G probably benign Het
Sh3tc1 C T 5: 35,697,448 V1302M probably benign Het
Slmap T C 14: 26,418,219 E780G possibly damaging Het
Snrpg T A 6: 86,376,576 V46E probably damaging Het
Sptbn5 T A 2: 120,047,577 Q953L noncoding transcript Het
Stard9 C T 2: 120,704,769 L3836F possibly damaging Het
Tcerg1 T A 18: 42,550,072 M619K probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tmem57 A G 4: 134,828,451 I237T probably benign Het
Tnfrsf9 C T 4: 150,933,099 T137M probably damaging Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trak1 G T 9: 121,460,499 E626* probably null Het
Trio G T 15: 27,855,022 H750Q possibly damaging Het
U2af2 T C 7: 5,067,415 probably benign Het
Vmn2r3 T C 3: 64,274,926 I451V probably benign Het
Zfp930 A T 8: 69,228,346 N230I probably benign Het
Other mutations in Egflam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01600:Egflam APN 15 7219764 missense probably damaging 1.00
IGL02352:Egflam APN 15 7234225 missense probably benign 0.01
IGL02359:Egflam APN 15 7234225 missense probably benign 0.01
IGL02389:Egflam APN 15 7250078 missense probably benign 0.01
IGL02400:Egflam APN 15 7247053 missense probably benign 0.00
IGL02530:Egflam APN 15 7222812 missense probably damaging 1.00
IGL02892:Egflam APN 15 7289796 missense probably benign
R0047:Egflam UTSW 15 7253430 missense possibly damaging 0.56
R0047:Egflam UTSW 15 7253430 missense possibly damaging 0.56
R0345:Egflam UTSW 15 7289994 splice site probably null
R0504:Egflam UTSW 15 7222758 missense probably damaging 1.00
R0532:Egflam UTSW 15 7234237 missense probably benign 0.19
R0573:Egflam UTSW 15 7242425 nonsense probably null
R0609:Egflam UTSW 15 7253523 missense possibly damaging 0.65
R0648:Egflam UTSW 15 7207709 missense probably damaging 1.00
R0653:Egflam UTSW 15 7250028 critical splice donor site probably null
R1099:Egflam UTSW 15 7252422 missense probably benign 0.00
R1711:Egflam UTSW 15 7289915 missense possibly damaging 0.85
R1842:Egflam UTSW 15 7303941 missense probably benign 0.00
R1964:Egflam UTSW 15 7247105 missense probably damaging 0.97
R2001:Egflam UTSW 15 7242567 missense probably benign 0.18
R2008:Egflam UTSW 15 7237804 missense possibly damaging 0.95
R2134:Egflam UTSW 15 7234279 missense probably damaging 0.97
R2852:Egflam UTSW 15 7219701 missense probably damaging 1.00
R2853:Egflam UTSW 15 7219701 missense probably damaging 1.00
R4257:Egflam UTSW 15 7254426 splice site probably null
R4346:Egflam UTSW 15 7234278 nonsense probably null
R4380:Egflam UTSW 15 7243869 missense possibly damaging 0.70
R4538:Egflam UTSW 15 7252437 missense probably damaging 1.00
R4746:Egflam UTSW 15 7224639 splice site probably null
R4909:Egflam UTSW 15 7219629 missense probably damaging 1.00
R5027:Egflam UTSW 15 7253644 missense probably benign 0.00
R5314:Egflam UTSW 15 7304012 missense probably damaging 1.00
R5439:Egflam UTSW 15 7224663 missense probably damaging 0.99
R5495:Egflam UTSW 15 7251241 missense probably damaging 1.00
R5626:Egflam UTSW 15 7251207 missense possibly damaging 0.89
R5931:Egflam UTSW 15 7243857 missense possibly damaging 0.49
R5977:Egflam UTSW 15 7318245 missense possibly damaging 0.94
R6258:Egflam UTSW 15 7234292 missense probably damaging 0.98
R6395:Egflam UTSW 15 7231695 missense probably damaging 1.00
R6497:Egflam UTSW 15 7251303 splice site probably null
R6736:Egflam UTSW 15 7219725 missense probably damaging 1.00
R7586:Egflam UTSW 15 7208601 missense probably damaging 1.00
R7764:Egflam UTSW 15 7318255 missense probably damaging 0.98
R7781:Egflam UTSW 15 7253746 missense probably null 0.94
R7842:Egflam UTSW 15 7251194 missense probably null 1.00
R8011:Egflam UTSW 15 7247044 missense possibly damaging 0.89
R8080:Egflam UTSW 15 7398080 missense probably benign 0.09
R8175:Egflam UTSW 15 7212152 missense probably damaging 1.00
R8553:Egflam UTSW 15 7207748 missense probably damaging 1.00
R8880:Egflam UTSW 15 7237768 missense probably damaging 0.98
X0024:Egflam UTSW 15 7304013 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGCCTGCTAGGAAACTCC -3'
(R):5'- TGCATGTACGACAATGCCATATTTC -3'

Sequencing Primer
(F):5'- GAAACTCCTTAGCACTAATTTATGCC -3'
(R):5'- ACGACAATGCCATATTTCATAAAAC -3'
Posted On2020-07-28