Mutagenetix > Incidental Mutation

Incidental Mutation 'R8301:Slc12a5'

639239

Institutional Source

Beutler Lab

Gene Symbol

Slc12a5

Ensembl Gene

ENSMUSG00000017740

Gene Name

solute carrier family 12, member 5

Synonyms

KCC2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8301 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

164960802-164999731 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 164993691 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 833 (N833I)

Ref Sequence

ENSEMBL: ENSMUSP00000144623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099092] [ENSMUST00000202136] [ENSMUST00000202223] [ENSMUST00000202479] [ENSMUST00000202623]

AlphaFold

Q91V14

Predicted Effect

probably damaging
Transcript: ENSMUST00000099092
AA Change: N810I

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000096690
Gene: ENSMUSG00000017740
AA Change: N810I

Domain	Start	End	E-Value	Type
low complexity region	10	22	N/A	INTRINSIC
low complexity region	77	90	N/A	INTRINSIC
Pfam:AA_permease	102	304	5.2e-22	PFAM
Pfam:AA_permease_2	364	632	1e-17	PFAM
Pfam:AA_permease	389	676	1.9e-42	PFAM
Pfam:SLC12	688	814	2.1e-19	PFAM
Pfam:SLC12	807	959	1.8e-20	PFAM
low complexity region	978	1002	N/A	INTRINSIC
Pfam:SLC12	1009	1115	2.1e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000202136

SMART Domains

Protein: ENSMUSP00000143973
Gene: ENSMUSG00000017740

Domain	Start	End	E-Value	Type
low complexity region	10	22	N/A	INTRINSIC
low complexity region	77	90	N/A	INTRINSIC
Pfam:AA_permease	102	175	2.5e-10	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000202223
AA Change: N833I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000143870
Gene: ENSMUSG00000017740
AA Change: N833I

Domain	Start	End	E-Value	Type
low complexity region	11	19	N/A	INTRINSIC
low complexity region	100	113	N/A	INTRINSIC
Pfam:AA_permease	125	327	1e-19	PFAM
Pfam:AA_permease_2	386	655	4.5e-15	PFAM
Pfam:AA_permease	412	699	3.7e-40	PFAM
Pfam:SLC12	711	837	7.2e-17	PFAM
Pfam:SLC12	830	982	6.2e-18	PFAM
low complexity region	1001	1025	N/A	INTRINSIC
Pfam:SLC12	1030	1133	8.6e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000202479

SMART Domains

Protein: ENSMUSP00000144540
Gene: ENSMUSG00000017740

Domain	Start	End	E-Value	Type
low complexity region	10	22	N/A	INTRINSIC
low complexity region	77	90	N/A	INTRINSIC
Pfam:AA_permease	102	176	5.2e-10	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000202623
AA Change: N833I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000144623
Gene: ENSMUSG00000017740
AA Change: N833I

Domain	Start	End	E-Value	Type
low complexity region	11	19	N/A	INTRINSIC
low complexity region	100	113	N/A	INTRINSIC
Pfam:AA_permease	125	327	5.3e-22	PFAM
Pfam:AA_permease_2	386	655	1.2e-17	PFAM
Pfam:AA_permease	412	699	2e-42	PFAM
Pfam:SLC12	711	837	2.1e-19	PFAM
Pfam:SLC12	830	982	1.8e-20	PFAM
low complexity region	1001	1025	N/A	INTRINSIC
Pfam:SLC12	1032	1138	2.2e-15	PFAM

Meta Mutation Damage Score

0.8784

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] K-Cl cotransporters are proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The protein encoded by this gene is an integral membrane K-Cl cotransporter that can function in either a net efflux or influx pathway, depending on the chemical concentration gradients of potassium and chloride. The encoded protein can act as a homomultimer, or as a heteromultimer with other K-Cl cotransporters, to maintain chloride homeostasis in neurons. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within a few minutes of birth of respiratory failure resulting from a motor nerve defect. Mice homozygous for a hypomorphic allele display postnatal lethality and tonic-clonic seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	A	T	5: 87,972,505	I374F	probably benign	Het
9430076C15Rik	A	G	6: 53,681,033	D116G	possibly damaging	Het
Ak9	G	A	10: 41,424,716	V1108I		Het
Aldh16a1	C	T	7: 45,141,982	A790T	possibly damaging	Het
Anks1	A	T	17: 28,059,580		probably benign	Het
Antxr2	T	G	5: 97,977,679	T240P	probably benign	Het
Arfgef1	A	T	1: 10,179,833	M945K	probably damaging	Het
Arhgef17	T	C	7: 100,879,659	T1591A	probably benign	Het
Aurka	A	G	2: 172,356,930	S374P	probably damaging	Het
Bccip	T	C	7: 133,719,204	S236P	probably benign	Het
Cacna1s	T	A	1: 136,073,441		probably benign	Het
Calm1	A	G	12: 100,205,685	E132G	probably benign	Het
Casz1	A	G	4: 148,946,043	D1173G	probably damaging	Het
Cdh17	A	G	4: 11,795,659	D413G	probably damaging	Het
Cfap57	A	G	4: 118,593,074	I617T	possibly damaging	Het
Csnka2ip	A	C	16: 64,478,991	S337A	unknown	Het
Ddx60	A	G	8: 62,000,597	E1250G	probably benign	Het
Dlgap2	T	A	8: 14,823,577	S727T	probably benign	Het
Dpy19l1	T	C	9: 24,485,111		probably benign	Het
Ebf2	A	G	14: 67,238,982	T134A	possibly damaging	Het
Echdc2	A	T	4: 108,172,909	M136L	probably benign	Het
Enpp2	A	G	15: 54,851,407	F598S	probably benign	Het
Extl3	A	C	14: 65,076,284	L483R	probably damaging	Het
Gcat	T	C	15: 79,035,889	V227A	possibly damaging	Het
Hsf2	A	G	10: 57,505,346	D344G	probably damaging	Het
Ighm	C	T	12: 113,421,545	G265D		Het
Igsf9b	T	G	9: 27,334,739		probably benign	Het
Ints6	A	G	14: 62,702,453	V596A	probably benign	Het
Ints8	T	C	4: 11,246,120	E182G	probably damaging	Het
Iqgap2	A	G	13: 95,682,151		probably null	Het
Kalrn	G	T	16: 34,357,100	Q250K	probably benign	Het
Lrrc1	T	A	9: 77,544,488	N46Y	probably damaging	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Naa50	A	G	16: 44,157,131	N74S	probably benign	Het
Neb	T	C	2: 52,288,835	N1303S	probably benign	Het
Nfs1	A	T	2: 156,134,493	C160*	probably null	Het
Olfr472	A	G	7: 107,903,626	K303R	probably benign	Het
Olfr591	T	G	7: 103,173,073	K188T	probably damaging	Het
Olfr740	T	A	14: 50,453,564	S171T	probably benign	Het
Olfr809	T	C	10: 129,776,840	S309P	probably benign	Het
Orm2	T	C	4: 63,363,026	F67S	possibly damaging	Het
Pex5	A	G	6: 124,405,183	S180P	probably benign	Het
Phf14	G	C	6: 11,992,062	G746R	probably damaging	Het
Pkm	T	A	9: 59,668,631	V110E	probably damaging	Het
Plekha6	T	G	1: 133,264,687	N78K	probably damaging	Het
Plxna2	G	A	1: 194,790,175	V1076I	probably benign	Het
Polq	C	A	16: 37,061,819	D1448E	probably damaging	Het
Pot1b	T	C	17: 55,687,895	T256A	probably benign	Het
Prkch	C	T	12: 73,702,764	T377I	possibly damaging	Het
Prl3c1	A	C	13: 27,199,185		probably benign	Het
Prl7b1	A	C	13: 27,602,772	V158G	possibly damaging	Het
Prss22	T	C	17: 23,993,981	S261G	probably damaging	Het
Psd	T	C	19: 46,321,102		probably benign	Het
Psg18	A	T	7: 18,353,377	Y119N	probably damaging	Het
Rbm6	T	G	9: 107,852,794	R218S	probably damaging	Het
Rnf213	T	A	11: 119,434,742	S1491T		Het
Rsf1	T	C	7: 97,661,925	S621P		Het
Runx1	C	A	16: 92,605,656	*466L	probably null	Het
Samd4	A	G	14: 47,016,678	I200V	probably benign	Het
Sdsl	C	T	5: 120,459,519	C241Y	probably benign	Het
Sepn1	T	C	4: 134,551,414		probably benign	Het
Setx	C	T	2: 29,145,690	P729L	possibly damaging	Het
Sf1	C	T	19: 6,368,366	Q55*	probably null	Het
Slc1a4	T	C	11: 20,332,286	R63G	probably damaging	Het
Tmeff2	G	T	1: 51,181,837	A324S	probably benign	Het
Tmem217	A	G	17: 29,526,492	I88T	possibly damaging	Het
Tnfsf8	A	T	4: 63,860,878	I61N	probably benign	Het
Tpbgl	G	T	7: 99,625,567	A361E	probably damaging	Het
Trhde	T	A	10: 114,487,006	E667V	probably benign	Het
Unc13b	A	G	4: 43,263,568	T1598A	probably benign	Het
Vmn2r73	A	T	7: 85,858,302	C601S	probably benign	Het
Zfp873	C	A	10: 82,060,879	H481Q	probably damaging	Het

Other mutations in Slc12a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Slc12a5	APN	2	164997121	missense	probably damaging	1.00
IGL00425:Slc12a5	APN	2	164983281	missense	probably damaging	1.00
IGL00976:Slc12a5	APN	2	164979304	missense	probably damaging	1.00
IGL01654:Slc12a5	APN	2	164973755	missense	possibly damaging	0.91
IGL01905:Slc12a5	APN	2	164990381	missense	probably benign	0.02
IGL02205:Slc12a5	APN	2	164996479	missense	probably benign	0.03
IGL02510:Slc12a5	APN	2	164982808	splice site	probably benign
IGL02746:Slc12a5	APN	2	164974916	missense	probably benign	0.01
G1Funyon:Slc12a5	UTSW	2	164993691	missense	probably damaging	0.98
R0051:Slc12a5	UTSW	2	164986663	missense	probably damaging	1.00
R0254:Slc12a5	UTSW	2	164997245	critical splice donor site	probably null
R0412:Slc12a5	UTSW	2	164994062	missense	probably benign	0.05
R0587:Slc12a5	UTSW	2	164976533	missense	probably damaging	1.00
R0835:Slc12a5	UTSW	2	164994038	missense	probably damaging	0.97
R0932:Slc12a5	UTSW	2	164996885	splice site	probably benign
R1643:Slc12a5	UTSW	2	164994027	missense	probably benign	0.01
R1700:Slc12a5	UTSW	2	164992376	missense	possibly damaging	0.94
R1760:Slc12a5	UTSW	2	164996128	missense	probably damaging	0.99
R2063:Slc12a5	UTSW	2	164997147	missense	probably damaging	1.00
R2293:Slc12a5	UTSW	2	164992330	missense	probably benign	0.03
R2412:Slc12a5	UTSW	2	164976462	critical splice donor site	probably null
R3035:Slc12a5	UTSW	2	164980258	missense	probably benign	0.06
R3116:Slc12a5	UTSW	2	164996181	splice site	probably null
R3412:Slc12a5	UTSW	2	164968431	missense	probably benign	0.26
R3788:Slc12a5	UTSW	2	164993775	missense	probably damaging	1.00
R4039:Slc12a5	UTSW	2	164992330	missense	probably benign	0.03
R4174:Slc12a5	UTSW	2	164979490	missense	probably damaging	1.00
R4492:Slc12a5	UTSW	2	164979343	missense	probably benign	0.08
R4608:Slc12a5	UTSW	2	164973765	missense	probably damaging	0.99
R4750:Slc12a5	UTSW	2	164982931	missense	probably benign	0.06
R4994:Slc12a5	UTSW	2	164983365	splice site	probably null
R5103:Slc12a5	UTSW	2	164992433	missense	probably damaging	1.00
R5539:Slc12a5	UTSW	2	164987206	missense	possibly damaging	0.94
R5632:Slc12a5	UTSW	2	164987221	missense	possibly damaging	0.86
R5771:Slc12a5	UTSW	2	164973768	missense	possibly damaging	0.88
R6139:Slc12a5	UTSW	2	164992311	missense	probably damaging	0.98
R6336:Slc12a5	UTSW	2	164992464	splice site	probably null
R6581:Slc12a5	UTSW	2	164987115	missense	probably damaging	1.00
R6706:Slc12a5	UTSW	2	164988589	missense	probably damaging	1.00
R6886:Slc12a5	UTSW	2	164982905	missense	probably benign
R7134:Slc12a5	UTSW	2	164974958	missense	probably damaging	1.00
R7310:Slc12a5	UTSW	2	164992440	missense	probably damaging	1.00
R7402:Slc12a5	UTSW	2	164982932	missense	probably benign	0.01
R8079:Slc12a5	UTSW	2	164992452	missense	probably damaging	1.00
R9105:Slc12a5	UTSW	2	164996194	missense	probably benign
R9132:Slc12a5	UTSW	2	164993956	intron	probably benign
R9431:Slc12a5	UTSW	2	164990258	missense	possibly damaging	0.95
R9580:Slc12a5	UTSW	2	164974976	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GAGTTCAAGGTCAAGGTCAGAC -3'
(R):5'- AAGGATCAACGGCGAATCCC -3'

Sequencing Primer
(F):5'- TTCAAGGTCAAGGTCAGACAGAGTG -3'
(R):5'- TGCATGGACACACCTACATGG -3'

Posted On

2020-07-28