Incidental Mutation 'R8301:Aurka'

• ID: 639240
• Institutional Source: Beutler Lab
• Gene Symbol: Aurka
• Ensembl Gene: ENSMUSG00000027496
• Gene Name: aurora kinase A
• Synonyms: IAK, IAK1, Aurora-A, aurora A, Ark1, Ayk1, AIRK1, Stk6
• MMRRC Submission: 067789-MU
• Accession Numbers:

  Ncbi RefSeq: NM_011497.3; MGI:894678

• Essential gene?: Essential (E-score: 1.000)
• Stock #: R8301 (G1)
• Quality Score: 225.009
• Status: Validated
• Chromosome: 2
• Chromosomal Location: 172356190-172370535 bp(-) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): A to G at 172356930 bp (GRCm38)
• Zygosity: Heterozygous
• Amino Acid Change: Serine to Proline at position 374 (S374P)
• Ref Sequence: ENSEMBL: ENSMUSP00000028997
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000028995] [ENSMUST00000028997] [ENSMUST00000109139] [ENSMUST00000109140]
• AlphaFold: P97477
• PDB Structure: Crystal structure of mouse Aurora A (Asn186->Gly, Lys240->Arg, Met302->Leu) in complex with 1-{5-[2-(thieno[3,2-d]pyrimidin-4-ylamino)-ethyl]- thiazol-2-yl}-3-(3-trifluoromethyl-phenyl)-urea [X-RAY DIFFRACTION] ; Crystal structure of mouse Aurora A (Asn186->Gly, Lys240->Arg, Met302->Leu) in complex with 1-(3-chloro-phenyl)-3-{5-[2-(thieno[3,2-d]pyrimidin-4-ylamino)- ethyl]-thiazol-2-yl}-urea [SNS-314] [X-RAY DIFFRACTION] ; Crystal structure of mouse Aurora A (Asn186->Gly, Lys240->Arg, Met302->Leu) in complex with 1-{5-[2-(1-methyl-1H-pyrazolo[4,3-d]pyrimidin-7-ylamino)-ethyl]-thiazol-2-yl}-3-(3-trifluoromethyl-phenyl)-urea [X-RAY DIFFRACTION] ; Crystal structure of mouse Aurora A (Asn186->Gly, Lys240->Arg, Met302->Leu) in complex with [7-(2-{2-[3-(3-chloro-phenyl)-ureido]-thiazol-5-yl}-ethylamino)-pyrazolo[4,3-d]pyrimidin-1-yl]-acetic acid [X-RAY DIFFRACTION] ; Crystal structure of Aurora A complexed with an inhibitor discovered through site-directed dynamic tethering [X-RAY DIFFRACTION] ; Crystal structure of the mouse Aurora-A catalytic domain (Asn186->Gly, Lys240->Arg, Met302->Leu) in complex with Compound 290. [X-RAY DIFFRACTION] ; Crystal structure of the mouse Aurora-A catalytic domain (Asn186->Gly, Lys240->Arg, Met302->Leu) in complex with Compound 823. [X-RAY DIFFRACTION] ; Crystal structure of the mouse Aurora-A catalytic domain (Asn186->Gly, Lys240->Arg, Met302->Leu) in complex with Compound 130. [X-RAY DIFFRACTION]
• Predicted Effect: probably benign; Transcript: ENSMUST00000028995
• SMART Domains: Protein: ENSMUSP00000028995; Gene: ENSMUSG00000027495

Domain	Start	End	E-Value	Type
Pfam:DUF1279	85	172	4e-30	PFAM

• Predicted Effect: probably damaging; Transcript: ENSMUST00000028997; AA Change: S374P; PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
• SMART Domains: Protein: ENSMUSP00000028997; Gene: ENSMUSG00000027496; AA Change: S374P

Domain	Start	End	E-Value	Type
S_TKc	146	396	2.25e-99	SMART

• Predicted Effect: probably damaging; Transcript: ENSMUST00000109139; AA Change: S352P; PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
• SMART Domains: Protein: ENSMUSP00000104767; Gene: ENSMUSG00000027496; AA Change: S352P

Domain	Start	End	E-Value	Type
S_TKc	124	374	2.25e-99	SMART

• Predicted Effect: probably damaging; Transcript: ENSMUST00000109140; AA Change: S352P; PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
• SMART Domains: Protein: ENSMUSP00000104768; Gene: ENSMUSG00000027496; AA Change: S352P

Domain	Start	End	E-Value	Type
S_TKc	124	374	2.25e-99	SMART

• Meta Mutation Damage Score: 0.4732
• Coding Region Coverage:
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
• Validation Efficiency: 100% (71/71)
• MGI Phenotype: Strain: 3836423; 3826513; Lethality: E1-E4; FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell cycle-regulated kinase that appears to be involved in microtubule formation and/or stabilization at the spindle pole during chromosome segregation. The encoded protein is found at the centrosome in interphase cells and at the spindle poles in mitosis. This gene may play a role in tumor development and progression. A processed pseudogene of this gene has been found on chromosome 1, and an unprocessed pseudogene has been found on chromosome 10. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for a null allele display embryonic lethality before implantation, early embryonic growth arrest, and impaired mitosis. Heterozygous null mice display increased incidence of tumors primarily lymphomas and chromosomal instability. [provided by MGI curators]
• Allele List at MGI:

  All alleles(25) : Targeted(4) Gene trapped(21)

• Posted On: 2020-07-28

Predicted Primers

PCR Primer
(F):5'- GTTTCTCACAGTTGCACGGTG -3'
(R):5'- CTCTGCTATGAGTTCCTAGTGG -3'

Sequencing Primer
(F):5'- GGCCGTGGTTCAGGATTCC -3'
(R):5'- TCCTTTCGAGGCACACACG -3'