Incidental Mutation 'R8301:Aurka'
ID 639240
Institutional Source Beutler Lab
Gene Symbol Aurka
Ensembl Gene ENSMUSG00000027496
Gene Name aurora kinase A
Synonyms IAK, IAK1, Aurora-A, aurora A, Ark1, Ayk1, AIRK1, Stk6
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_011497.3; MGI:894678

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8301 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 172356190-172370535 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 172356930 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 374 (S374P)
Ref Sequence ENSEMBL: ENSMUSP00000028997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028995] [ENSMUST00000028997] [ENSMUST00000109139] [ENSMUST00000109140]
AlphaFold P97477
PDB Structure Crystal structure of mouse Aurora A (Asn186->Gly, Lys240->Arg, Met302->Leu) in complex with 1-{5-[2-(thieno[3,2-d]pyrimidin-4-ylamino)-ethyl]- thiazol-2-yl}-3-(3-trifluoromethyl-phenyl)-urea [X-RAY DIFFRACTION]
Crystal structure of mouse Aurora A (Asn186->Gly, Lys240->Arg, Met302->Leu) in complex with 1-(3-chloro-phenyl)-3-{5-[2-(thieno[3,2-d]pyrimidin-4-ylamino)- ethyl]-thiazol-2-yl}-urea [SNS-314] [X-RAY DIFFRACTION]
Crystal structure of mouse Aurora A (Asn186->Gly, Lys240->Arg, Met302->Leu) in complex with 1-{5-[2-(1-methyl-1H-pyrazolo[4,3-d]pyrimidin-7-ylamino)-ethyl]-thiazol-2-yl}-3-(3-trifluoromethyl-phenyl)-urea [X-RAY DIFFRACTION]
Crystal structure of mouse Aurora A (Asn186->Gly, Lys240->Arg, Met302->Leu) in complex with [7-(2-{2-[3-(3-chloro-phenyl)-ureido]-thiazol-5-yl}-ethylamino)-pyrazolo[4,3-d]pyrimidin-1-yl]-acetic acid [X-RAY DIFFRACTION]
Crystal structure of Aurora A complexed with an inhibitor discovered through site-directed dynamic tethering [X-RAY DIFFRACTION]
Crystal structure of the mouse Aurora-A catalytic domain (Asn186->Gly, Lys240->Arg, Met302->Leu) in complex with Compound 290. [X-RAY DIFFRACTION]
Crystal structure of the mouse Aurora-A catalytic domain (Asn186->Gly, Lys240->Arg, Met302->Leu) in complex with Compound 823. [X-RAY DIFFRACTION]
Crystal structure of the mouse Aurora-A catalytic domain (Asn186->Gly, Lys240->Arg, Met302->Leu) in complex with Compound 130. [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028995
SMART Domains Protein: ENSMUSP00000028995
Gene: ENSMUSG00000027495

DomainStartEndE-ValueType
Pfam:DUF1279 85 172 4e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000028997
AA Change: S374P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028997
Gene: ENSMUSG00000027496
AA Change: S374P

DomainStartEndE-ValueType
S_TKc 146 396 2.25e-99 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109139
AA Change: S352P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104767
Gene: ENSMUSG00000027496
AA Change: S352P

DomainStartEndE-ValueType
S_TKc 124 374 2.25e-99 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109140
AA Change: S352P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104768
Gene: ENSMUSG00000027496
AA Change: S352P

DomainStartEndE-ValueType
S_TKc 124 374 2.25e-99 SMART
Meta Mutation Damage Score 0.4732 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype Strain: 3836423; 3826513
Lethality: E1-E4
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell cycle-regulated kinase that appears to be involved in microtubule formation and/or stabilization at the spindle pole during chromosome segregation. The encoded protein is found at the centrosome in interphase cells and at the spindle poles in mitosis. This gene may play a role in tumor development and progression. A processed pseudogene of this gene has been found on chromosome 1, and an unprocessed pseudogene has been found on chromosome 10. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display embryonic lethality before implantation, early embryonic growth arrest, and impaired mitosis. Heterozygous null mice display increased incidence of tumors primarily lymphomas and chromosomal instability. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(4) Gene trapped(21)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,972,505 I374F probably benign Het
9430076C15Rik A G 6: 53,681,033 D116G possibly damaging Het
Ak9 G A 10: 41,424,716 V1108I Het
Aldh16a1 C T 7: 45,141,982 A790T possibly damaging Het
Anks1 A T 17: 28,059,580 probably benign Het
Antxr2 T G 5: 97,977,679 T240P probably benign Het
Arfgef1 A T 1: 10,179,833 M945K probably damaging Het
Arhgef17 T C 7: 100,879,659 T1591A probably benign Het
Bccip T C 7: 133,719,204 S236P probably benign Het
Cacna1s T A 1: 136,073,441 probably benign Het
Calm1 A G 12: 100,205,685 E132G probably benign Het
Casz1 A G 4: 148,946,043 D1173G probably damaging Het
Cdh17 A G 4: 11,795,659 D413G probably damaging Het
Cfap57 A G 4: 118,593,074 I617T possibly damaging Het
Csnka2ip A C 16: 64,478,991 S337A unknown Het
Ddx60 A G 8: 62,000,597 E1250G probably benign Het
Dlgap2 T A 8: 14,823,577 S727T probably benign Het
Dpy19l1 T C 9: 24,485,111 probably benign Het
Ebf2 A G 14: 67,238,982 T134A possibly damaging Het
Echdc2 A T 4: 108,172,909 M136L probably benign Het
Enpp2 A G 15: 54,851,407 F598S probably benign Het
Extl3 A C 14: 65,076,284 L483R probably damaging Het
Gcat T C 15: 79,035,889 V227A possibly damaging Het
Hsf2 A G 10: 57,505,346 D344G probably damaging Het
Ighm C T 12: 113,421,545 G265D Het
Igsf9b T G 9: 27,334,739 probably benign Het
Ints6 A G 14: 62,702,453 V596A probably benign Het
Ints8 T C 4: 11,246,120 E182G probably damaging Het
Iqgap2 A G 13: 95,682,151 probably null Het
Kalrn G T 16: 34,357,100 Q250K probably benign Het
Lrrc1 T A 9: 77,544,488 N46Y probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naa50 A G 16: 44,157,131 N74S probably benign Het
Neb T C 2: 52,288,835 N1303S probably benign Het
Nfs1 A T 2: 156,134,493 C160* probably null Het
Olfr472 A G 7: 107,903,626 K303R probably benign Het
Olfr591 T G 7: 103,173,073 K188T probably damaging Het
Olfr740 T A 14: 50,453,564 S171T probably benign Het
Olfr809 T C 10: 129,776,840 S309P probably benign Het
Orm2 T C 4: 63,363,026 F67S possibly damaging Het
Pex5 A G 6: 124,405,183 S180P probably benign Het
Phf14 G C 6: 11,992,062 G746R probably damaging Het
Pkm T A 9: 59,668,631 V110E probably damaging Het
Plekha6 T G 1: 133,264,687 N78K probably damaging Het
Plxna2 G A 1: 194,790,175 V1076I probably benign Het
Polq C A 16: 37,061,819 D1448E probably damaging Het
Pot1b T C 17: 55,687,895 T256A probably benign Het
Prkch C T 12: 73,702,764 T377I possibly damaging Het
Prl3c1 A C 13: 27,199,185 probably benign Het
Prl7b1 A C 13: 27,602,772 V158G possibly damaging Het
Prss22 T C 17: 23,993,981 S261G probably damaging Het
Psd T C 19: 46,321,102 probably benign Het
Psg18 A T 7: 18,353,377 Y119N probably damaging Het
Rbm6 T G 9: 107,852,794 R218S probably damaging Het
Rnf213 T A 11: 119,434,742 S1491T Het
Rsf1 T C 7: 97,661,925 S621P Het
Runx1 C A 16: 92,605,656 *466L probably null Het
Samd4 A G 14: 47,016,678 I200V probably benign Het
Sdsl C T 5: 120,459,519 C241Y probably benign Het
Sepn1 T C 4: 134,551,414 probably benign Het
Setx C T 2: 29,145,690 P729L possibly damaging Het
Sf1 C T 19: 6,368,366 Q55* probably null Het
Slc12a5 A T 2: 164,993,691 N833I probably damaging Het
Slc1a4 T C 11: 20,332,286 R63G probably damaging Het
Tmeff2 G T 1: 51,181,837 A324S probably benign Het
Tmem217 A G 17: 29,526,492 I88T possibly damaging Het
Tnfsf8 A T 4: 63,860,878 I61N probably benign Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trhde T A 10: 114,487,006 E667V probably benign Het
Unc13b A G 4: 43,263,568 T1598A probably benign Het
Vmn2r73 A T 7: 85,858,302 C601S probably benign Het
Zfp873 C A 10: 82,060,879 H481Q probably damaging Het
Other mutations in Aurka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Aurka APN 2 172368979 unclassified probably benign
IGL02338:Aurka APN 2 172359858 missense probably benign 0.00
IGL02894:Aurka APN 2 172366948 splice site probably null
IGL03188:Aurka APN 2 172363768 missense possibly damaging 0.60
G1Funyon:Aurka UTSW 2 172356930 missense probably damaging 0.99
PIT4585001:Aurka UTSW 2 172357197 missense probably benign 0.01
R0006:Aurka UTSW 2 172359753 critical splice donor site probably null
R0006:Aurka UTSW 2 172359753 critical splice donor site probably null
R0458:Aurka UTSW 2 172370446 nonsense probably null
R0555:Aurka UTSW 2 172367147 missense probably benign 0.07
R1130:Aurka UTSW 2 172357258 splice site probably null
R1140:Aurka UTSW 2 172357229 missense probably damaging 1.00
R2507:Aurka UTSW 2 172370445 missense probably benign 0.00
R2887:Aurka UTSW 2 172367120 missense probably benign 0.01
R2889:Aurka UTSW 2 172367120 missense probably benign 0.01
R3772:Aurka UTSW 2 172366960 missense probably benign
R4929:Aurka UTSW 2 172370406 missense probably benign 0.05
R5409:Aurka UTSW 2 172367116 missense possibly damaging 0.78
R6158:Aurka UTSW 2 172363596 critical splice donor site probably null
R6689:Aurka UTSW 2 172370393 critical splice donor site probably null
R6828:Aurka UTSW 2 172357252 missense probably damaging 1.00
R7912:Aurka UTSW 2 172369029 missense probably benign 0.00
R8066:Aurka UTSW 2 172370418 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTTCTCACAGTTGCACGGTG -3'
(R):5'- CTCTGCTATGAGTTCCTAGTGG -3'

Sequencing Primer
(F):5'- GGCCGTGGTTCAGGATTCC -3'
(R):5'- TCCTTTCGAGGCACACACG -3'
Posted On 2020-07-28