Incidental Mutation 'R8301:Cdh17'
ID 639242
Institutional Source Beutler Lab
Gene Symbol Cdh17
Ensembl Gene ENSMUSG00000028217
Gene Name cadherin 17
Synonyms BILL-cadherin, LI-cadherin, HPT-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock # R8301 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 11758147-11817895 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 11795659 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 413 (D413G)
Ref Sequence ENSEMBL: ENSMUSP00000029871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029871] [ENSMUST00000108303]
AlphaFold Q9R100
Predicted Effect probably damaging
Transcript: ENSMUST00000029871
AA Change: D413G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029871
Gene: ENSMUSG00000028217
AA Change: D413G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 44 123 5.27e-10 SMART
CA 147 241 6.9e-14 SMART
CA 258 337 3.05e-15 SMART
CA 361 446 3.29e-11 SMART
CA 471 564 5.27e-10 SMART
CA 587 664 5.59e-23 SMART
Blast:CA 687 771 5e-39 BLAST
transmembrane domain 784 806 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108303
AA Change: D413G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103938
Gene: ENSMUSG00000028217
AA Change: D413G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 44 123 5.27e-10 SMART
CA 147 241 6.9e-14 SMART
CA 258 337 3.05e-15 SMART
CA 361 446 3.29e-11 SMART
CA 471 564 5.27e-10 SMART
CA 587 664 5.59e-23 SMART
Meta Mutation Damage Score 0.2339 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. The encoded protein is cadherin-like, consisting of an extracellular region, containing 7 cadherin domains, and a transmembrane region but lacking the conserved cytoplasmic domain. The protein is a component of the gastrointestinal tract and pancreatic ducts, acting as an intestinal proton-dependent peptide transporter in the first step in oral absorption of many medically important peptide-based drugs. The protein may also play a role in the morphological organization of liver and intestine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mutant mice exhibit impaired B lymphocyte development and impaired IgG1 and IgG3 antibody response to T-independent antigen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,972,505 I374F probably benign Het
9430076C15Rik A G 6: 53,681,033 D116G possibly damaging Het
Ak9 G A 10: 41,424,716 V1108I Het
Aldh16a1 C T 7: 45,141,982 A790T possibly damaging Het
Anks1 A T 17: 28,059,580 probably benign Het
Antxr2 T G 5: 97,977,679 T240P probably benign Het
Arfgef1 A T 1: 10,179,833 M945K probably damaging Het
Arhgef17 T C 7: 100,879,659 T1591A probably benign Het
Aurka A G 2: 172,356,930 S374P probably damaging Het
Bccip T C 7: 133,719,204 S236P probably benign Het
Cacna1s T A 1: 136,073,441 probably benign Het
Calm1 A G 12: 100,205,685 E132G probably benign Het
Casz1 A G 4: 148,946,043 D1173G probably damaging Het
Cfap57 A G 4: 118,593,074 I617T possibly damaging Het
Csnka2ip A C 16: 64,478,991 S337A unknown Het
Ddx60 A G 8: 62,000,597 E1250G probably benign Het
Dlgap2 T A 8: 14,823,577 S727T probably benign Het
Dpy19l1 T C 9: 24,485,111 probably benign Het
Ebf2 A G 14: 67,238,982 T134A possibly damaging Het
Echdc2 A T 4: 108,172,909 M136L probably benign Het
Enpp2 A G 15: 54,851,407 F598S probably benign Het
Extl3 A C 14: 65,076,284 L483R probably damaging Het
Gcat T C 15: 79,035,889 V227A possibly damaging Het
Hsf2 A G 10: 57,505,346 D344G probably damaging Het
Ighm C T 12: 113,421,545 G265D Het
Igsf9b T G 9: 27,334,739 probably benign Het
Ints6 A G 14: 62,702,453 V596A probably benign Het
Ints8 T C 4: 11,246,120 E182G probably damaging Het
Iqgap2 A G 13: 95,682,151 probably null Het
Kalrn G T 16: 34,357,100 Q250K probably benign Het
Lrrc1 T A 9: 77,544,488 N46Y probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naa50 A G 16: 44,157,131 N74S probably benign Het
Neb T C 2: 52,288,835 N1303S probably benign Het
Nfs1 A T 2: 156,134,493 C160* probably null Het
Olfr472 A G 7: 107,903,626 K303R probably benign Het
Olfr591 T G 7: 103,173,073 K188T probably damaging Het
Olfr740 T A 14: 50,453,564 S171T probably benign Het
Olfr809 T C 10: 129,776,840 S309P probably benign Het
Orm2 T C 4: 63,363,026 F67S possibly damaging Het
Pex5 A G 6: 124,405,183 S180P probably benign Het
Phf14 G C 6: 11,992,062 G746R probably damaging Het
Pkm T A 9: 59,668,631 V110E probably damaging Het
Plekha6 T G 1: 133,264,687 N78K probably damaging Het
Plxna2 G A 1: 194,790,175 V1076I probably benign Het
Polq C A 16: 37,061,819 D1448E probably damaging Het
Pot1b T C 17: 55,687,895 T256A probably benign Het
Prkch C T 12: 73,702,764 T377I possibly damaging Het
Prl3c1 A C 13: 27,199,185 probably benign Het
Prl7b1 A C 13: 27,602,772 V158G possibly damaging Het
Prss22 T C 17: 23,993,981 S261G probably damaging Het
Psd T C 19: 46,321,102 probably benign Het
Psg18 A T 7: 18,353,377 Y119N probably damaging Het
Rbm6 T G 9: 107,852,794 R218S probably damaging Het
Rnf213 T A 11: 119,434,742 S1491T Het
Rsf1 T C 7: 97,661,925 S621P Het
Runx1 C A 16: 92,605,656 *466L probably null Het
Samd4 A G 14: 47,016,678 I200V probably benign Het
Sdsl C T 5: 120,459,519 C241Y probably benign Het
Sepn1 T C 4: 134,551,414 probably benign Het
Setx C T 2: 29,145,690 P729L possibly damaging Het
Sf1 C T 19: 6,368,366 Q55* probably null Het
Slc12a5 A T 2: 164,993,691 N833I probably damaging Het
Slc1a4 T C 11: 20,332,286 R63G probably damaging Het
Tmeff2 G T 1: 51,181,837 A324S probably benign Het
Tmem217 A G 17: 29,526,492 I88T possibly damaging Het
Tnfsf8 A T 4: 63,860,878 I61N probably benign Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trhde T A 10: 114,487,006 E667V probably benign Het
Unc13b A G 4: 43,263,568 T1598A probably benign Het
Vmn2r73 A T 7: 85,858,302 C601S probably benign Het
Zfp873 C A 10: 82,060,879 H481Q probably damaging Het
Other mutations in Cdh17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Cdh17 APN 4 11797780 splice site probably benign
IGL00823:Cdh17 APN 4 11783412 missense possibly damaging 0.78
IGL00824:Cdh17 APN 4 11784675 missense probably benign 0.00
IGL01572:Cdh17 APN 4 11784621 splice site probably benign
IGL01602:Cdh17 APN 4 11795670 missense probably damaging 1.00
IGL01605:Cdh17 APN 4 11795670 missense probably damaging 1.00
IGL01759:Cdh17 APN 4 11771262 splice site probably benign
IGL02065:Cdh17 APN 4 11771373 splice site probably benign
IGL02448:Cdh17 APN 4 11784680 missense probably benign
IGL02869:Cdh17 APN 4 11814908 missense probably benign 0.00
IGL03088:Cdh17 APN 4 11810473 missense probably damaging 1.00
Disruptive UTSW 4 11784654 missense probably damaging 1.00
G1Funyon:Cdh17 UTSW 4 11795659 missense probably damaging 0.99
R0054:Cdh17 UTSW 4 11785186 missense possibly damaging 0.59
R0081:Cdh17 UTSW 4 11785280 splice site probably benign
R0101:Cdh17 UTSW 4 11771341 missense probably benign 0.00
R0432:Cdh17 UTSW 4 11771273 nonsense probably null
R0718:Cdh17 UTSW 4 11810451 missense possibly damaging 0.68
R0946:Cdh17 UTSW 4 11795581 missense probably benign 0.01
R1076:Cdh17 UTSW 4 11795581 missense probably benign 0.01
R1217:Cdh17 UTSW 4 11799676 missense probably benign 0.04
R2060:Cdh17 UTSW 4 11803982 missense probably benign 0.03
R3808:Cdh17 UTSW 4 11795671 missense probably damaging 0.99
R3850:Cdh17 UTSW 4 11785201 missense probably damaging 1.00
R4111:Cdh17 UTSW 4 11814628 missense probably damaging 0.99
R4112:Cdh17 UTSW 4 11814628 missense probably damaging 0.99
R4583:Cdh17 UTSW 4 11810466 missense probably benign 0.00
R4683:Cdh17 UTSW 4 11817036 missense possibly damaging 0.78
R4797:Cdh17 UTSW 4 11810390 missense probably benign 0.00
R5050:Cdh17 UTSW 4 11784654 missense probably damaging 1.00
R5071:Cdh17 UTSW 4 11810325 missense probably damaging 0.98
R5569:Cdh17 UTSW 4 11816990 missense probably damaging 0.96
R5790:Cdh17 UTSW 4 11814945 splice site probably null
R6077:Cdh17 UTSW 4 11803969 missense probably benign 0.22
R6581:Cdh17 UTSW 4 11799615 missense probably damaging 1.00
R7274:Cdh17 UTSW 4 11783174 nonsense probably null
R7647:Cdh17 UTSW 4 11814698 missense probably damaging 1.00
R7649:Cdh17 UTSW 4 11814698 missense probably damaging 1.00
R7934:Cdh17 UTSW 4 11799754 critical splice donor site probably null
R8290:Cdh17 UTSW 4 11817037 missense probably benign
R8690:Cdh17 UTSW 4 11783163 missense probably benign 0.05
R8709:Cdh17 UTSW 4 11795685 nonsense probably null
R8818:Cdh17 UTSW 4 11771323 missense probably damaging 1.00
R8940:Cdh17 UTSW 4 11783226 missense probably damaging 1.00
R9243:Cdh17 UTSW 4 11771333 missense probably benign 0.26
R9325:Cdh17 UTSW 4 11810319 missense probably damaging 0.99
X0067:Cdh17 UTSW 4 11785224 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCATCGGGATCTTTGAGGC -3'
(R):5'- GACACCTAGTTCTCAGAGGACC -3'

Sequencing Primer
(F):5'- ATCGGGATCTTTGAGGCCCATG -3'
(R):5'- GACAATGCGATGTCTCCGAATCTG -3'
Posted On 2020-07-28