Mutagenetix > Incidental Mutation

Incidental Mutation 'R8301:Cdh17'

639242

Institutional Source

Beutler Lab

Gene Symbol

Cdh17

Ensembl Gene

ENSMUSG00000028217

Gene Name

cadherin 17

Synonyms

BILL-cadherin, LI-cadherin, HPT-1

MMRRC Submission

067789-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.130) question?

Stock #

R8301 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

11758147-11817895 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 11795659 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 413 (D413G)

Ref Sequence

ENSEMBL: ENSMUSP00000029871 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029871] [ENSMUST00000108303]

AlphaFold

Q9R100

Predicted Effect

probably damaging
Transcript: ENSMUST00000029871
AA Change: D413G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000029871
Gene: ENSMUSG00000028217
AA Change: D413G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CA	44	123	5.27e-10	SMART
CA	147	241	6.9e-14	SMART
CA	258	337	3.05e-15	SMART
CA	361	446	3.29e-11	SMART
CA	471	564	5.27e-10	SMART
CA	587	664	5.59e-23	SMART
Blast:CA	687	771	5e-39	BLAST
transmembrane domain	784	806	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108303
AA Change: D413G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000103938
Gene: ENSMUSG00000028217
AA Change: D413G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CA	44	123	5.27e-10	SMART
CA	147	241	6.9e-14	SMART
CA	258	337	3.05e-15	SMART
CA	361	446	3.29e-11	SMART
CA	471	564	5.27e-10	SMART
CA	587	664	5.59e-23	SMART

Meta Mutation Damage Score

0.2339

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. The encoded protein is cadherin-like, consisting of an extracellular region, containing 7 cadherin domains, and a transmembrane region but lacking the conserved cytoplasmic domain. The protein is a component of the gastrointestinal tract and pancreatic ducts, acting as an intestinal proton-dependent peptide transporter in the first step in oral absorption of many medically important peptide-based drugs. The protein may also play a role in the morphological organization of liver and intestine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mutant mice exhibit impaired B lymphocyte development and impaired IgG1 and IgG3 antibody response to T-independent antigen. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	A	T	5: 87,972,505	I374F	probably benign	Het
Ak9	G	A	10: 41,424,716	V1108I		Het
Aldh16a1	C	T	7: 45,141,982	A790T	possibly damaging	Het
Anks1	A	T	17: 28,059,580		probably benign	Het
Antxr2	T	G	5: 97,977,679	T240P	probably benign	Het
Arfgef1	A	T	1: 10,179,833	M945K	probably damaging	Het
Arhgef17	T	C	7: 100,879,659	T1591A	probably benign	Het
Aurka	A	G	2: 172,356,930	S374P	probably damaging	Het
Bccip	T	C	7: 133,719,204	S236P	probably benign	Het
Cacna1s	T	A	1: 136,073,441		probably benign	Het
Calm1	A	G	12: 100,205,685	E132G	probably benign	Het
Casz1	A	G	4: 148,946,043	D1173G	probably damaging	Het
Cfap57	A	G	4: 118,593,074	I617T	possibly damaging	Het
Creb5	A	G	6: 53,681,033	D116G	possibly damaging	Het
Csnka2ip	A	C	16: 64,478,991	S337A	unknown	Het
Ddx60	A	G	8: 62,000,597	E1250G	probably benign	Het
Dlgap2	T	A	8: 14,823,577	S727T	probably benign	Het
Dpy19l1	T	C	9: 24,485,111		probably benign	Het
Ebf2	A	G	14: 67,238,982	T134A	possibly damaging	Het
Echdc2	A	T	4: 108,172,909	M136L	probably benign	Het
Enpp2	A	G	15: 54,851,407	F598S	probably benign	Het
Extl3	A	C	14: 65,076,284	L483R	probably damaging	Het
Gcat	T	C	15: 79,035,889	V227A	possibly damaging	Het
Hsf2	A	G	10: 57,505,346	D344G	probably damaging	Het
Ighm	C	T	12: 113,421,545	G265D		Het
Igsf9b	T	G	9: 27,334,739		probably benign	Het
Ints6	A	G	14: 62,702,453	V596A	probably benign	Het
Ints8	T	C	4: 11,246,120	E182G	probably damaging	Het
Iqgap2	A	G	13: 95,682,151		probably null	Het
Kalrn	G	T	16: 34,357,100	Q250K	probably benign	Het
Lrrc1	T	A	9: 77,544,488	N46Y	probably damaging	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Naa50	A	G	16: 44,157,131	N74S	probably benign	Het
Neb	T	C	2: 52,288,835	N1303S	probably benign	Het
Nfs1	A	T	2: 156,134,493	C160*	probably null	Het
Olfr472	A	G	7: 107,903,626	K303R	probably benign	Het
Olfr591	T	G	7: 103,173,073	K188T	probably damaging	Het
Olfr740	T	A	14: 50,453,564	S171T	probably benign	Het
Olfr809	T	C	10: 129,776,840	S309P	probably benign	Het
Orm2	T	C	4: 63,363,026	F67S	possibly damaging	Het
Pex5	A	G	6: 124,405,183	S180P	probably benign	Het
Phf14	G	C	6: 11,992,062	G746R	probably damaging	Het
Pkm	T	A	9: 59,668,631	V110E	probably damaging	Het
Plekha6	T	G	1: 133,264,687	N78K	probably damaging	Het
Plxna2	G	A	1: 194,790,175	V1076I	probably benign	Het
Polq	C	A	16: 37,061,819	D1448E	probably damaging	Het
Pot1b	T	C	17: 55,687,895	T256A	probably benign	Het
Prkch	C	T	12: 73,702,764	T377I	possibly damaging	Het
Prl3c1	A	C	13: 27,199,185		probably benign	Het
Prl7b1	A	C	13: 27,602,772	V158G	possibly damaging	Het
Prss22	T	C	17: 23,993,981	S261G	probably damaging	Het
Psd	T	C	19: 46,321,102		probably benign	Het
Psg18	A	T	7: 18,353,377	Y119N	probably damaging	Het
Rbm6	T	G	9: 107,852,794	R218S	probably damaging	Het
Rnf213	T	A	11: 119,434,742	S1491T		Het
Rsf1	T	C	7: 97,661,925	S621P		Het
Runx1	C	A	16: 92,605,656	*466L	probably null	Het
Samd4	A	G	14: 47,016,678	I200V	probably benign	Het
Sdsl	C	T	5: 120,459,519	C241Y	probably benign	Het
Selenon	T	C	4: 134,551,414		probably benign	Het
Setx	C	T	2: 29,145,690	P729L	possibly damaging	Het
Sf1	C	T	19: 6,368,366	Q55*	probably null	Het
Slc12a5	A	T	2: 164,993,691	N833I	probably damaging	Het
Slc1a4	T	C	11: 20,332,286	R63G	probably damaging	Het
Tmeff2	G	T	1: 51,181,837	A324S	probably benign	Het
Tmem217	A	G	17: 29,526,492	I88T	possibly damaging	Het
Tnfsf8	A	T	4: 63,860,878	I61N	probably benign	Het
Tpbgl	G	T	7: 99,625,567	A361E	probably damaging	Het
Trhde	T	A	10: 114,487,006	E667V	probably benign	Het
Unc13b	A	G	4: 43,263,568	T1598A	probably benign	Het
Vmn2r73	A	T	7: 85,858,302	C601S	probably benign	Het
Zfp873	C	A	10: 82,060,879	H481Q	probably damaging	Het

Other mutations in Cdh17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00715:Cdh17	APN	4	11797780	splice site	probably benign
IGL00823:Cdh17	APN	4	11783412	missense	possibly damaging	0.78
IGL00824:Cdh17	APN	4	11784675	missense	probably benign	0.00
IGL01572:Cdh17	APN	4	11784621	splice site	probably benign
IGL01602:Cdh17	APN	4	11795670	missense	probably damaging	1.00
IGL01605:Cdh17	APN	4	11795670	missense	probably damaging	1.00
IGL01759:Cdh17	APN	4	11771262	splice site	probably benign
IGL02065:Cdh17	APN	4	11771373	splice site	probably benign
IGL02448:Cdh17	APN	4	11784680	missense	probably benign
IGL02869:Cdh17	APN	4	11814908	missense	probably benign	0.00
IGL03088:Cdh17	APN	4	11810473	missense	probably damaging	1.00
Disruptive	UTSW	4	11784654	missense	probably damaging	1.00
G1Funyon:Cdh17	UTSW	4	11795659	missense	probably damaging	0.99
R0054:Cdh17	UTSW	4	11785186	missense	possibly damaging	0.59
R0081:Cdh17	UTSW	4	11785280	splice site	probably benign
R0101:Cdh17	UTSW	4	11771341	missense	probably benign	0.00
R0432:Cdh17	UTSW	4	11771273	nonsense	probably null
R0718:Cdh17	UTSW	4	11810451	missense	possibly damaging	0.68
R0946:Cdh17	UTSW	4	11795581	missense	probably benign	0.01
R1076:Cdh17	UTSW	4	11795581	missense	probably benign	0.01
R1217:Cdh17	UTSW	4	11799676	missense	probably benign	0.04
R2060:Cdh17	UTSW	4	11803982	missense	probably benign	0.03
R3808:Cdh17	UTSW	4	11795671	missense	probably damaging	0.99
R3850:Cdh17	UTSW	4	11785201	missense	probably damaging	1.00
R4111:Cdh17	UTSW	4	11814628	missense	probably damaging	0.99
R4112:Cdh17	UTSW	4	11814628	missense	probably damaging	0.99
R4583:Cdh17	UTSW	4	11810466	missense	probably benign	0.00
R4683:Cdh17	UTSW	4	11817036	missense	possibly damaging	0.78
R4797:Cdh17	UTSW	4	11810390	missense	probably benign	0.00
R5050:Cdh17	UTSW	4	11784654	missense	probably damaging	1.00
R5071:Cdh17	UTSW	4	11810325	missense	probably damaging	0.98
R5569:Cdh17	UTSW	4	11816990	missense	probably damaging	0.96
R5790:Cdh17	UTSW	4	11814945	splice site	probably null
R6077:Cdh17	UTSW	4	11803969	missense	probably benign	0.22
R6581:Cdh17	UTSW	4	11799615	missense	probably damaging	1.00
R7274:Cdh17	UTSW	4	11783174	nonsense	probably null
R7647:Cdh17	UTSW	4	11814698	missense	probably damaging	1.00
R7649:Cdh17	UTSW	4	11814698	missense	probably damaging	1.00
R7934:Cdh17	UTSW	4	11799754	critical splice donor site	probably null
R8290:Cdh17	UTSW	4	11817037	missense	probably benign
R8690:Cdh17	UTSW	4	11783163	missense	probably benign	0.05
R8709:Cdh17	UTSW	4	11795685	nonsense	probably null
R8818:Cdh17	UTSW	4	11771323	missense	probably damaging	1.00
R8940:Cdh17	UTSW	4	11783226	missense	probably damaging	1.00
R9243:Cdh17	UTSW	4	11771333	missense	probably benign	0.26
R9325:Cdh17	UTSW	4	11810319	missense	probably damaging	0.99
R9457:Cdh17	UTSW	4	11771329	missense	probably damaging	0.98
X0067:Cdh17	UTSW	4	11785224	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGCATCGGGATCTTTGAGGC -3'
(R):5'- GACACCTAGTTCTCAGAGGACC -3'

Sequencing Primer
(F):5'- ATCGGGATCTTTGAGGCCCATG -3'
(R):5'- GACAATGCGATGTCTCCGAATCTG -3'

Posted On

2020-07-28