Incidental Mutation 'R8301:Tnfsf8'
ID639245
Institutional Source Beutler Lab
Gene Symbol Tnfsf8
Ensembl Gene ENSMUSG00000028362
Gene Nametumor necrosis factor (ligand) superfamily, member 8
SynonymsCD153, CD30LG, Cd30L
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8301 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location63831308-63861347 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 63860878 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 61 (I61N)
Ref Sequence ENSEMBL: ENSMUSP00000030047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030047]
Predicted Effect probably benign
Transcript: ENSMUST00000030047
AA Change: I61N

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030047
Gene: ENSMUSG00000028362
AA Change: I61N

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
transmembrane domain 45 67 N/A INTRINSIC
TNF 103 235 2.64e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for TNFRSF8/CD30, which is a cell surface antigen and a marker for Hodgkin lymphoma and related hematologic malignancies. The engagement of this cytokine expressed on B cell surface plays an inhibitory role in modulating Ig class switch. This cytokine was shown to enhance cell proliferation of some lymphoma cell lines, while to induce cell death and reduce cell proliferation of other lymphoma cell lines. The pleiotropic biologic activities of this cytokine on different CD30+ lymphoma cell lines may play a pathophysiologic role in Hodgkin's and some non-Hodgkin's lymphomas. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice diplay decreased susceptibility to graft versus host disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,972,505 I374F probably benign Het
9430076C15Rik A G 6: 53,681,033 D116G possibly damaging Het
Ak9 G A 10: 41,424,716 V1108I Het
Aldh16a1 C T 7: 45,141,982 A790T possibly damaging Het
Antxr2 T G 5: 97,977,679 T240P probably benign Het
Arfgef1 A T 1: 10,179,833 M945K probably damaging Het
Arhgef17 T C 7: 100,879,659 T1591A probably benign Het
Aurka A G 2: 172,356,930 S374P probably damaging Het
Bccip T C 7: 133,719,204 S236P probably benign Het
Calm1 A G 12: 100,205,685 E132G probably benign Het
Casz1 A G 4: 148,946,043 D1173G probably damaging Het
Cdh17 A G 4: 11,795,659 D413G probably damaging Het
Cfap57 A G 4: 118,593,074 I617T possibly damaging Het
Csnka2ip A C 16: 64,478,991 S337A unknown Het
Ddx60 A G 8: 62,000,597 E1250G probably benign Het
Dlgap2 T A 8: 14,823,577 S727T probably benign Het
Ebf2 A G 14: 67,238,982 T134A possibly damaging Het
Echdc2 A T 4: 108,172,909 M136L probably benign Het
Enpp2 A G 15: 54,851,407 F598S probably benign Het
Extl3 A C 14: 65,076,284 L483R probably damaging Het
Gcat T C 15: 79,035,889 V227A possibly damaging Het
Hsf2 A G 10: 57,505,346 D344G probably damaging Het
Ighm C T 12: 113,421,545 G265D Het
Ints6 A G 14: 62,702,453 V596A probably benign Het
Ints8 T C 4: 11,246,120 E182G probably damaging Het
Iqgap2 A G 13: 95,682,151 probably null Het
Kalrn G T 16: 34,357,100 Q250K probably benign Het
Lrrc1 T A 9: 77,544,488 N46Y probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naa50 A G 16: 44,157,131 N74S probably benign Het
Neb T C 2: 52,288,835 N1303S probably benign Het
Nfs1 A T 2: 156,134,493 C160* probably null Het
Olfr472 A G 7: 107,903,626 K303R probably benign Het
Olfr591 T G 7: 103,173,073 K188T probably damaging Het
Olfr740 T A 14: 50,453,564 S171T probably benign Het
Olfr809 T C 10: 129,776,840 S309P probably benign Het
Orm2 T C 4: 63,363,026 F67S possibly damaging Het
Pex5 A G 6: 124,405,183 S180P probably benign Het
Phf14 G C 6: 11,992,062 G746R probably damaging Het
Pkm T A 9: 59,668,631 V110E probably damaging Het
Plekha6 T G 1: 133,264,687 N78K probably damaging Het
Plxna2 G A 1: 194,790,175 V1076I probably benign Het
Polq C A 16: 37,061,819 D1448E probably damaging Het
Pot1b T C 17: 55,687,895 T256A probably benign Het
Prkch C T 12: 73,702,764 T377I possibly damaging Het
Prl7b1 A C 13: 27,602,772 V158G possibly damaging Het
Prss22 T C 17: 23,993,981 S261G probably damaging Het
Psg18 A T 7: 18,353,377 Y119N probably damaging Het
Rbm6 T G 9: 107,852,794 R218S probably damaging Het
Rnf213 T A 11: 119,434,742 S1491T Het
Rsf1 T C 7: 97,661,925 S621P Het
Runx1 C A 16: 92,605,656 *466L probably null Het
Samd4 A G 14: 47,016,678 I200V probably benign Het
Sdsl C T 5: 120,459,519 C241Y probably benign Het
Setx C T 2: 29,145,690 P729L possibly damaging Het
Sf1 C T 19: 6,368,366 Q55* probably null Het
Slc12a5 A T 2: 164,993,691 N833I probably damaging Het
Slc1a4 T C 11: 20,332,286 R63G probably damaging Het
Tmeff2 G T 1: 51,181,837 A324S probably benign Het
Tmem217 A G 17: 29,526,492 I88T possibly damaging Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trhde T A 10: 114,487,006 E667V probably benign Het
Unc13b A G 4: 43,263,568 T1598A probably benign Het
Vmn2r73 A T 7: 85,858,302 C601S probably benign Het
Zfp873 C A 10: 82,060,879 H481Q probably damaging Het
Other mutations in Tnfsf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Tnfsf8 APN 4 63834510 splice site probably benign
P0045:Tnfsf8 UTSW 4 63851167 splice site probably benign
R0322:Tnfsf8 UTSW 4 63834166 missense probably damaging 0.96
R1167:Tnfsf8 UTSW 4 63837086 missense possibly damaging 0.55
R3821:Tnfsf8 UTSW 4 63860890 missense probably benign 0.17
R3893:Tnfsf8 UTSW 4 63860959 missense possibly damaging 0.86
R4154:Tnfsf8 UTSW 4 63834358 missense probably benign 0.00
R4380:Tnfsf8 UTSW 4 63861027 nonsense probably null
R4597:Tnfsf8 UTSW 4 63837100 missense probably damaging 1.00
R7502:Tnfsf8 UTSW 4 63851161 missense probably damaging 1.00
R7740:Tnfsf8 UTSW 4 63834446 missense possibly damaging 0.70
R8062:Tnfsf8 UTSW 4 63861195 start gained probably benign
R8126:Tnfsf8 UTSW 4 63834186 missense possibly damaging 0.94
R8335:Tnfsf8 UTSW 4 63834115 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCCCACTGAGTGCAGAAAG -3'
(R):5'- CTTGGAACAGAGCTGGGTACAG -3'

Sequencing Primer
(F):5'- CCCACTGAGTGCAGAAAGTTCATTTC -3'
(R):5'- TGTGGGACAGACTATATAAAGCATG -3'
Posted On2020-07-28