Incidental Mutation 'R8301:Casz1'
ID639248
Institutional Source Beutler Lab
Gene Symbol Casz1
Ensembl Gene ENSMUSG00000028977
Gene Namecastor zinc finger 1
SynonymsD4Ertd432e, 2410019P08Rik, Cst, castor
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8301 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location148804429-148954889 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 148946043 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1173 (D1173G)
Ref Sequence ENSEMBL: ENSMUSP00000112978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094464] [ENSMUST00000122222]
Predicted Effect probably benign
Transcript: ENSMUST00000094464
SMART Domains Protein: ENSMUSP00000092035
Gene: ENSMUSG00000028977

DomainStartEndE-ValueType
low complexity region 403 420 N/A INTRINSIC
ZnF_C2H2 489 514 5.34e0 SMART
ZnF_C2H2 550 574 8.09e-1 SMART
ZnF_C2H2 609 633 9.3e-1 SMART
low complexity region 643 658 N/A INTRINSIC
ZnF_C2H2 667 691 1.1e-2 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 728 766 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 810 834 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 951 957 N/A INTRINSIC
ZnF_C2H2 1031 1055 2.29e1 SMART
low complexity region 1080 1091 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122222
AA Change: D1173G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112978
Gene: ENSMUSG00000028977
AA Change: D1173G

DomainStartEndE-ValueType
low complexity region 403 420 N/A INTRINSIC
ZnF_C2H2 489 514 5.34e0 SMART
ZnF_C2H2 550 574 8.09e-1 SMART
ZnF_C2H2 609 633 9.3e-1 SMART
low complexity region 643 658 N/A INTRINSIC
ZnF_C2H2 667 691 1.1e-2 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 728 766 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 810 834 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 951 957 N/A INTRINSIC
ZnF_C2H2 1031 1055 2.29e1 SMART
low complexity region 1080 1091 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
ZnF_C2H2 1182 1206 1.59e1 SMART
ZnF_C2H2 1242 1266 2.47e1 SMART
ZnF_C2H2 1300 1324 3.47e0 SMART
ZnF_C2H2 1457 1481 7.89e0 SMART
ZnF_C2H2 1515 1537 3.21e1 SMART
ZnF_C2H2 1571 1595 3.99e0 SMART
low complexity region 1632 1649 N/A INTRINSIC
SCOP:d1qbkb_ 1675 1742 2e-5 SMART
Meta Mutation Damage Score 0.1644 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor. The encoded protein may function as a tumor suppressor, and single nucleotide polymorphisms in this gene are associated with blood pressure variation. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete lethality throughout fetal growth and development and abnormal heart development associated with edema, decreased fetal cardiomyocyte proliferation, myocardium hypoplasia, ventricular septal defect, and altered heart shape and Z line formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,972,505 I374F probably benign Het
9430076C15Rik A G 6: 53,681,033 D116G possibly damaging Het
Ak9 G A 10: 41,424,716 V1108I Het
Aldh16a1 C T 7: 45,141,982 A790T possibly damaging Het
Anks1 A T 17: 28,059,580 probably benign Het
Antxr2 T G 5: 97,977,679 T240P probably benign Het
Arfgef1 A T 1: 10,179,833 M945K probably damaging Het
Arhgef17 T C 7: 100,879,659 T1591A probably benign Het
Aurka A G 2: 172,356,930 S374P probably damaging Het
Bccip T C 7: 133,719,204 S236P probably benign Het
Cacna1s T A 1: 136,073,441 probably benign Het
Calm1 A G 12: 100,205,685 E132G probably benign Het
Cdh17 A G 4: 11,795,659 D413G probably damaging Het
Cfap57 A G 4: 118,593,074 I617T possibly damaging Het
Csnka2ip A C 16: 64,478,991 S337A unknown Het
Ddx60 A G 8: 62,000,597 E1250G probably benign Het
Dlgap2 T A 8: 14,823,577 S727T probably benign Het
Dpy19l1 T C 9: 24,485,111 probably benign Het
Ebf2 A G 14: 67,238,982 T134A possibly damaging Het
Echdc2 A T 4: 108,172,909 M136L probably benign Het
Enpp2 A G 15: 54,851,407 F598S probably benign Het
Extl3 A C 14: 65,076,284 L483R probably damaging Het
Gcat T C 15: 79,035,889 V227A possibly damaging Het
Hsf2 A G 10: 57,505,346 D344G probably damaging Het
Ighm C T 12: 113,421,545 G265D Het
Igsf9b T G 9: 27,334,739 probably benign Het
Ints6 A G 14: 62,702,453 V596A probably benign Het
Ints8 T C 4: 11,246,120 E182G probably damaging Het
Iqgap2 A G 13: 95,682,151 probably null Het
Kalrn G T 16: 34,357,100 Q250K probably benign Het
Lrrc1 T A 9: 77,544,488 N46Y probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naa50 A G 16: 44,157,131 N74S probably benign Het
Neb T C 2: 52,288,835 N1303S probably benign Het
Nfs1 A T 2: 156,134,493 C160* probably null Het
Olfr472 A G 7: 107,903,626 K303R probably benign Het
Olfr591 T G 7: 103,173,073 K188T probably damaging Het
Olfr740 T A 14: 50,453,564 S171T probably benign Het
Olfr809 T C 10: 129,776,840 S309P probably benign Het
Orm2 T C 4: 63,363,026 F67S possibly damaging Het
Pex5 A G 6: 124,405,183 S180P probably benign Het
Phf14 G C 6: 11,992,062 G746R probably damaging Het
Pkm T A 9: 59,668,631 V110E probably damaging Het
Plekha6 T G 1: 133,264,687 N78K probably damaging Het
Plxna2 G A 1: 194,790,175 V1076I probably benign Het
Polq C A 16: 37,061,819 D1448E probably damaging Het
Pot1b T C 17: 55,687,895 T256A probably benign Het
Prkch C T 12: 73,702,764 T377I possibly damaging Het
Prl3c1 A C 13: 27,199,185 probably benign Het
Prl7b1 A C 13: 27,602,772 V158G possibly damaging Het
Prss22 T C 17: 23,993,981 S261G probably damaging Het
Psd T C 19: 46,321,102 probably benign Het
Psg18 A T 7: 18,353,377 Y119N probably damaging Het
Rbm6 T G 9: 107,852,794 R218S probably damaging Het
Rnf213 T A 11: 119,434,742 S1491T Het
Rsf1 T C 7: 97,661,925 S621P Het
Runx1 C A 16: 92,605,656 *466L probably null Het
Samd4 A G 14: 47,016,678 I200V probably benign Het
Sdsl C T 5: 120,459,519 C241Y probably benign Het
Sepn1 T C 4: 134,551,414 probably benign Het
Setx C T 2: 29,145,690 P729L possibly damaging Het
Sf1 C T 19: 6,368,366 Q55* probably null Het
Slc12a5 A T 2: 164,993,691 N833I probably damaging Het
Slc1a4 T C 11: 20,332,286 R63G probably damaging Het
Tmeff2 G T 1: 51,181,837 A324S probably benign Het
Tmem217 A G 17: 29,526,492 I88T possibly damaging Het
Tnfsf8 A T 4: 63,860,878 I61N probably benign Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trhde T A 10: 114,487,006 E667V probably benign Het
Unc13b A G 4: 43,263,568 T1598A probably benign Het
Vmn2r73 A T 7: 85,858,302 C601S probably benign Het
Zfp873 C A 10: 82,060,879 H481Q probably damaging Het
Other mutations in Casz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Casz1 APN 4 148929371 missense probably damaging 1.00
IGL02137:Casz1 APN 4 148933468 missense possibly damaging 0.71
IGL02176:Casz1 APN 4 148934619 missense probably damaging 1.00
IGL02629:Casz1 APN 4 148944391 missense probably benign 0.01
IGL02871:Casz1 APN 4 148944319 missense possibly damaging 0.93
FR4340:Casz1 UTSW 4 148952302 small deletion probably benign
G1Funyon:Casz1 UTSW 4 148946043 missense probably damaging 0.98
H8562:Casz1 UTSW 4 148933451 missense probably damaging 1.00
R0090:Casz1 UTSW 4 148933411 missense probably benign 0.00
R0389:Casz1 UTSW 4 148948911 missense possibly damaging 0.83
R0443:Casz1 UTSW 4 148948911 missense possibly damaging 0.83
R0550:Casz1 UTSW 4 148952284 small deletion probably benign
R0597:Casz1 UTSW 4 148944394 missense probably benign 0.00
R1117:Casz1 UTSW 4 148934595 missense probably damaging 1.00
R1476:Casz1 UTSW 4 148946171 missense probably benign 0.05
R1540:Casz1 UTSW 4 148942900 unclassified probably benign
R1610:Casz1 UTSW 4 148929087 missense possibly damaging 0.54
R1764:Casz1 UTSW 4 148942900 unclassified probably benign
R1779:Casz1 UTSW 4 148932937 missense probably benign 0.00
R1874:Casz1 UTSW 4 148943211 missense probably damaging 0.99
R1902:Casz1 UTSW 4 148936195 missense possibly damaging 0.95
R1914:Casz1 UTSW 4 148932958 missense probably damaging 1.00
R2126:Casz1 UTSW 4 148946064 missense probably damaging 0.99
R2261:Casz1 UTSW 4 148929099 missense probably damaging 0.96
R2262:Casz1 UTSW 4 148929099 missense probably damaging 0.96
R3874:Casz1 UTSW 4 148939589 intron probably benign
R4019:Casz1 UTSW 4 148932878 missense probably benign 0.00
R4355:Casz1 UTSW 4 148952335 missense unknown
R4420:Casz1 UTSW 4 148948918 missense possibly damaging 0.90
R4610:Casz1 UTSW 4 148933267 missense probably damaging 1.00
R4632:Casz1 UTSW 4 148951855 missense possibly damaging 0.71
R4762:Casz1 UTSW 4 148938981 missense probably damaging 1.00
R4824:Casz1 UTSW 4 148944571 missense probably damaging 1.00
R4907:Casz1 UTSW 4 148944541 missense probably damaging 1.00
R5628:Casz1 UTSW 4 148946096 missense probably damaging 1.00
R5736:Casz1 UTSW 4 148929410 missense probably benign 0.00
R5929:Casz1 UTSW 4 148938696 missense probably damaging 1.00
R5929:Casz1 UTSW 4 148938969 missense probably damaging 1.00
R5932:Casz1 UTSW 4 148939113 missense possibly damaging 0.52
R6016:Casz1 UTSW 4 148934584 missense probably damaging 1.00
R6019:Casz1 UTSW 4 148947038 missense probably damaging 0.99
R6139:Casz1 UTSW 4 148951697 missense probably damaging 1.00
R6223:Casz1 UTSW 4 148933383 missense probably damaging 1.00
R6239:Casz1 UTSW 4 148938277 missense probably damaging 1.00
R6323:Casz1 UTSW 4 148941704 missense possibly damaging 0.89
R6354:Casz1 UTSW 4 148952542 missense unknown
R6454:Casz1 UTSW 4 148951495 missense probably damaging 0.99
R6479:Casz1 UTSW 4 148937078 missense probably damaging 1.00
R6529:Casz1 UTSW 4 148938189 missense probably damaging 1.00
R6772:Casz1 UTSW 4 148943206 missense probably damaging 1.00
R7000:Casz1 UTSW 4 148929236 missense probably damaging 1.00
R7152:Casz1 UTSW 4 148901291 start gained probably benign
R7324:Casz1 UTSW 4 148947033 missense probably damaging 0.99
R7339:Casz1 UTSW 4 148951745 missense probably damaging 1.00
R7388:Casz1 UTSW 4 148952393 missense unknown
R7480:Casz1 UTSW 4 148944586 missense probably damaging 0.99
R7719:Casz1 UTSW 4 148944524 missense probably damaging 0.99
R7789:Casz1 UTSW 4 148929406 missense probably benign
R7801:Casz1 UTSW 4 148938249 missense probably damaging 0.99
R7815:Casz1 UTSW 4 148929305 missense possibly damaging 0.89
R7818:Casz1 UTSW 4 148946076 missense probably damaging 1.00
R7938:Casz1 UTSW 4 148944486 missense probably benign 0.05
R8045:Casz1 UTSW 4 148932779 missense probably damaging 1.00
R8134:Casz1 UTSW 4 148943035 missense probably damaging 1.00
R8165:Casz1 UTSW 4 148944431 missense probably damaging 1.00
R8419:Casz1 UTSW 4 148948583 missense probably benign 0.29
RF001:Casz1 UTSW 4 148952304 small deletion probably benign
RF063:Casz1 UTSW 4 148952304 small deletion probably benign
X0018:Casz1 UTSW 4 148939008 missense probably damaging 1.00
X0064:Casz1 UTSW 4 148932952 missense probably damaging 0.99
Z1088:Casz1 UTSW 4 148944359 missense probably benign
Z1176:Casz1 UTSW 4 148944359 missense probably benign
Z1177:Casz1 UTSW 4 148933306 missense probably damaging 1.00
Z1177:Casz1 UTSW 4 148944359 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGTTCCCGTTGAGCAGGAG -3'
(R):5'- TCTCTGCCAGGAGAAGCTTG -3'

Sequencing Primer
(F):5'- CCGTTGAGCAGGAGGGTGAC -3'
(R):5'- TCACTGACCTGGTTGGGACAC -3'
Posted On2020-07-28