Incidental Mutation 'R8301:Olfr472'
ID 639263
Institutional Source Beutler Lab
Gene Symbol Olfr472
Ensembl Gene ENSMUSG00000073893
Gene Name olfactory receptor 472
Synonyms MOR204-5, GA_x6K02T2PBJ9-10231953-10232885
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R8301 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 107897902-107907762 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 107903626 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 303 (K303R)
Ref Sequence ENSEMBL: ENSMUSP00000147272 (fasta)
AlphaFold Q8VG43
Predicted Effect probably benign
Transcript: ENSMUST00000209670
Predicted Effect probably benign
Transcript: ENSMUST00000210420
AA Change: K303R

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210856
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,972,505 I374F probably benign Het
9430076C15Rik A G 6: 53,681,033 D116G possibly damaging Het
Ak9 G A 10: 41,424,716 V1108I Het
Aldh16a1 C T 7: 45,141,982 A790T possibly damaging Het
Anks1 A T 17: 28,059,580 probably benign Het
Antxr2 T G 5: 97,977,679 T240P probably benign Het
Arfgef1 A T 1: 10,179,833 M945K probably damaging Het
Arhgef17 T C 7: 100,879,659 T1591A probably benign Het
Aurka A G 2: 172,356,930 S374P probably damaging Het
Bccip T C 7: 133,719,204 S236P probably benign Het
Cacna1s T A 1: 136,073,441 probably benign Het
Calm1 A G 12: 100,205,685 E132G probably benign Het
Casz1 A G 4: 148,946,043 D1173G probably damaging Het
Cdh17 A G 4: 11,795,659 D413G probably damaging Het
Cfap57 A G 4: 118,593,074 I617T possibly damaging Het
Csnka2ip A C 16: 64,478,991 S337A unknown Het
Ddx60 A G 8: 62,000,597 E1250G probably benign Het
Dlgap2 T A 8: 14,823,577 S727T probably benign Het
Dpy19l1 T C 9: 24,485,111 probably benign Het
Ebf2 A G 14: 67,238,982 T134A possibly damaging Het
Echdc2 A T 4: 108,172,909 M136L probably benign Het
Enpp2 A G 15: 54,851,407 F598S probably benign Het
Extl3 A C 14: 65,076,284 L483R probably damaging Het
Gcat T C 15: 79,035,889 V227A possibly damaging Het
Hsf2 A G 10: 57,505,346 D344G probably damaging Het
Ighm C T 12: 113,421,545 G265D Het
Igsf9b T G 9: 27,334,739 probably benign Het
Ints6 A G 14: 62,702,453 V596A probably benign Het
Ints8 T C 4: 11,246,120 E182G probably damaging Het
Iqgap2 A G 13: 95,682,151 probably null Het
Kalrn G T 16: 34,357,100 Q250K probably benign Het
Lrrc1 T A 9: 77,544,488 N46Y probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naa50 A G 16: 44,157,131 N74S probably benign Het
Neb T C 2: 52,288,835 N1303S probably benign Het
Nfs1 A T 2: 156,134,493 C160* probably null Het
Olfr591 T G 7: 103,173,073 K188T probably damaging Het
Olfr740 T A 14: 50,453,564 S171T probably benign Het
Olfr809 T C 10: 129,776,840 S309P probably benign Het
Orm2 T C 4: 63,363,026 F67S possibly damaging Het
Pex5 A G 6: 124,405,183 S180P probably benign Het
Phf14 G C 6: 11,992,062 G746R probably damaging Het
Pkm T A 9: 59,668,631 V110E probably damaging Het
Plekha6 T G 1: 133,264,687 N78K probably damaging Het
Plxna2 G A 1: 194,790,175 V1076I probably benign Het
Polq C A 16: 37,061,819 D1448E probably damaging Het
Pot1b T C 17: 55,687,895 T256A probably benign Het
Prkch C T 12: 73,702,764 T377I possibly damaging Het
Prl3c1 A C 13: 27,199,185 probably benign Het
Prl7b1 A C 13: 27,602,772 V158G possibly damaging Het
Prss22 T C 17: 23,993,981 S261G probably damaging Het
Psd T C 19: 46,321,102 probably benign Het
Psg18 A T 7: 18,353,377 Y119N probably damaging Het
Rbm6 T G 9: 107,852,794 R218S probably damaging Het
Rnf213 T A 11: 119,434,742 S1491T Het
Rsf1 T C 7: 97,661,925 S621P Het
Runx1 C A 16: 92,605,656 *466L probably null Het
Samd4 A G 14: 47,016,678 I200V probably benign Het
Sdsl C T 5: 120,459,519 C241Y probably benign Het
Sepn1 T C 4: 134,551,414 probably benign Het
Setx C T 2: 29,145,690 P729L possibly damaging Het
Sf1 C T 19: 6,368,366 Q55* probably null Het
Slc12a5 A T 2: 164,993,691 N833I probably damaging Het
Slc1a4 T C 11: 20,332,286 R63G probably damaging Het
Tmeff2 G T 1: 51,181,837 A324S probably benign Het
Tmem217 A G 17: 29,526,492 I88T possibly damaging Het
Tnfsf8 A T 4: 63,860,878 I61N probably benign Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trhde T A 10: 114,487,006 E667V probably benign Het
Unc13b A G 4: 43,263,568 T1598A probably benign Het
Vmn2r73 A T 7: 85,858,302 C601S probably benign Het
Zfp873 C A 10: 82,060,879 H481Q probably damaging Het
Other mutations in Olfr472
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Olfr472 APN 7 107903104 missense probably damaging 1.00
IGL02002:Olfr472 APN 7 107903290 missense possibly damaging 0.81
IGL02320:Olfr472 APN 7 107902831 missense possibly damaging 0.78
IGL02701:Olfr472 APN 7 107903442 missense probably benign 0.42
IGL03022:Olfr472 APN 7 107902981 missense probably benign 0.18
IGL03214:Olfr472 APN 7 107902966 missense probably benign 0.00
IGL03257:Olfr472 APN 7 107902756 missense probably benign 0.01
IGL03372:Olfr472 APN 7 107903370 missense probably damaging 1.00
G1Funyon:Olfr472 UTSW 7 107903626 missense probably benign 0.24
R0081:Olfr472 UTSW 7 107903005 missense probably benign 0.00
R0669:Olfr472 UTSW 7 107903239 missense probably damaging 1.00
R0932:Olfr472 UTSW 7 107903190 missense possibly damaging 0.94
R1158:Olfr472 UTSW 7 107902923 missense possibly damaging 0.75
R1746:Olfr472 UTSW 7 107902886 missense probably benign 0.01
R3777:Olfr472 UTSW 7 107902747 missense probably benign
R3778:Olfr472 UTSW 7 107902747 missense probably benign
R4605:Olfr472 UTSW 7 107903238 missense probably benign 0.24
R4661:Olfr472 UTSW 7 107902981 missense probably benign 0.18
R4675:Olfr472 UTSW 7 107903360 missense probably damaging 1.00
R5374:Olfr472 UTSW 7 107903491 missense possibly damaging 0.52
R5686:Olfr472 UTSW 7 107902912 missense probably damaging 0.99
R6030:Olfr472 UTSW 7 107903413 missense probably benign 0.06
R6030:Olfr472 UTSW 7 107903413 missense probably benign 0.06
R6164:Olfr472 UTSW 7 107903388 missense probably benign 0.01
R6347:Olfr472 UTSW 7 107902950 missense possibly damaging 0.68
R6995:Olfr472 UTSW 7 107903622 missense probably benign 0.13
R7035:Olfr472 UTSW 7 107902933 missense probably benign
R7818:Olfr472 UTSW 7 107903023 missense probably benign 0.01
R7890:Olfr472 UTSW 7 107903043 missense probably benign 0.01
R8189:Olfr472 UTSW 7 107902732 missense probably damaging 0.99
R8965:Olfr472 UTSW 7 107903107 missense probably damaging 1.00
R9269:Olfr472 UTSW 7 107903320 missense possibly damaging 0.94
Z1176:Olfr472 UTSW 7 107903058 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGTCACTCTCTTCTATGGG -3'
(R):5'- TGCAGAAGTTCAACAGTAGCAATG -3'

Sequencing Primer
(F):5'- ATGGGACCATTACCGTCATTTACG -3'
(R):5'- TTCAGTGACATCAACTAGTCCTAC -3'
Posted On 2020-07-28