Incidental Mutation 'R8301:Pkm'
ID 639267
Institutional Source Beutler Lab
Gene Symbol Pkm
Ensembl Gene ENSMUSG00000032294
Gene Name pyruvate kinase, muscle
Synonyms Pkm2, Pk-3, Pk-2, Pk3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8301 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 59656368-59679375 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 59668631 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 110 (V110E)
Ref Sequence ENSEMBL: ENSMUSP00000034834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034834] [ENSMUST00000163694]
AlphaFold P52480
Predicted Effect probably damaging
Transcript: ENSMUST00000034834
AA Change: V110E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034834
Gene: ENSMUSG00000032294
AA Change: V110E

DomainStartEndE-ValueType
Pfam:PK 42 395 1.3e-172 PFAM
Pfam:PK_C 409 529 3.1e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163694
AA Change: V110E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128770
Gene: ENSMUSG00000032294
AA Change: V110E

DomainStartEndE-ValueType
Pfam:PK 42 395 2.6e-174 PFAM
Pfam:PK_C 410 528 1.9e-36 PFAM
Meta Mutation Damage Score 0.9414 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in glycolysis. The encoded protein is a pyruvate kinase that catalyzes the transfer of a phosphoryl group from phosphoenolpyruvate to ADP, generating ATP and pyruvate. This protein has been shown to interact with thyroid hormone and may mediate cellular metabolic effects induced by thyroid hormones. This protein has been found to bind Opa protein, a bacterial outer membrane protein involved in gonococcal adherence to and invasion of human cells, suggesting a role of this protein in bacterial pathogenesis. Several alternatively spliced transcript variants encoding a few distinct isoforms have been reported. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit prenatal lethality around the time of implanatation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,972,505 I374F probably benign Het
9430076C15Rik A G 6: 53,681,033 D116G possibly damaging Het
Ak9 G A 10: 41,424,716 V1108I Het
Aldh16a1 C T 7: 45,141,982 A790T possibly damaging Het
Anks1 A T 17: 28,059,580 probably benign Het
Antxr2 T G 5: 97,977,679 T240P probably benign Het
Arfgef1 A T 1: 10,179,833 M945K probably damaging Het
Arhgef17 T C 7: 100,879,659 T1591A probably benign Het
Aurka A G 2: 172,356,930 S374P probably damaging Het
Bccip T C 7: 133,719,204 S236P probably benign Het
Cacna1s T A 1: 136,073,441 probably benign Het
Calm1 A G 12: 100,205,685 E132G probably benign Het
Casz1 A G 4: 148,946,043 D1173G probably damaging Het
Cdh17 A G 4: 11,795,659 D413G probably damaging Het
Cfap57 A G 4: 118,593,074 I617T possibly damaging Het
Csnka2ip A C 16: 64,478,991 S337A unknown Het
Ddx60 A G 8: 62,000,597 E1250G probably benign Het
Dlgap2 T A 8: 14,823,577 S727T probably benign Het
Dpy19l1 T C 9: 24,485,111 probably benign Het
Ebf2 A G 14: 67,238,982 T134A possibly damaging Het
Echdc2 A T 4: 108,172,909 M136L probably benign Het
Enpp2 A G 15: 54,851,407 F598S probably benign Het
Extl3 A C 14: 65,076,284 L483R probably damaging Het
Gcat T C 15: 79,035,889 V227A possibly damaging Het
Hsf2 A G 10: 57,505,346 D344G probably damaging Het
Ighm C T 12: 113,421,545 G265D Het
Igsf9b T G 9: 27,334,739 probably benign Het
Ints6 A G 14: 62,702,453 V596A probably benign Het
Ints8 T C 4: 11,246,120 E182G probably damaging Het
Iqgap2 A G 13: 95,682,151 probably null Het
Kalrn G T 16: 34,357,100 Q250K probably benign Het
Lrrc1 T A 9: 77,544,488 N46Y probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naa50 A G 16: 44,157,131 N74S probably benign Het
Neb T C 2: 52,288,835 N1303S probably benign Het
Nfs1 A T 2: 156,134,493 C160* probably null Het
Olfr472 A G 7: 107,903,626 K303R probably benign Het
Olfr591 T G 7: 103,173,073 K188T probably damaging Het
Olfr740 T A 14: 50,453,564 S171T probably benign Het
Olfr809 T C 10: 129,776,840 S309P probably benign Het
Orm2 T C 4: 63,363,026 F67S possibly damaging Het
Pex5 A G 6: 124,405,183 S180P probably benign Het
Phf14 G C 6: 11,992,062 G746R probably damaging Het
Plekha6 T G 1: 133,264,687 N78K probably damaging Het
Plxna2 G A 1: 194,790,175 V1076I probably benign Het
Polq C A 16: 37,061,819 D1448E probably damaging Het
Pot1b T C 17: 55,687,895 T256A probably benign Het
Prkch C T 12: 73,702,764 T377I possibly damaging Het
Prl3c1 A C 13: 27,199,185 probably benign Het
Prl7b1 A C 13: 27,602,772 V158G possibly damaging Het
Prss22 T C 17: 23,993,981 S261G probably damaging Het
Psd T C 19: 46,321,102 probably benign Het
Psg18 A T 7: 18,353,377 Y119N probably damaging Het
Rbm6 T G 9: 107,852,794 R218S probably damaging Het
Rnf213 T A 11: 119,434,742 S1491T Het
Rsf1 T C 7: 97,661,925 S621P Het
Runx1 C A 16: 92,605,656 *466L probably null Het
Samd4 A G 14: 47,016,678 I200V probably benign Het
Sdsl C T 5: 120,459,519 C241Y probably benign Het
Sepn1 T C 4: 134,551,414 probably benign Het
Setx C T 2: 29,145,690 P729L possibly damaging Het
Sf1 C T 19: 6,368,366 Q55* probably null Het
Slc12a5 A T 2: 164,993,691 N833I probably damaging Het
Slc1a4 T C 11: 20,332,286 R63G probably damaging Het
Tmeff2 G T 1: 51,181,837 A324S probably benign Het
Tmem217 A G 17: 29,526,492 I88T possibly damaging Het
Tnfsf8 A T 4: 63,860,878 I61N probably benign Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trhde T A 10: 114,487,006 E667V probably benign Het
Unc13b A G 4: 43,263,568 T1598A probably benign Het
Vmn2r73 A T 7: 85,858,302 C601S probably benign Het
Zfp873 C A 10: 82,060,879 H481Q probably damaging Het
Other mutations in Pkm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01693:Pkm APN 9 59670522 missense probably damaging 1.00
IGL02014:Pkm APN 9 59668961 missense possibly damaging 0.59
IGL02054:Pkm APN 9 59678201 missense probably damaging 1.00
negligible UTSW 9 59670634 missense probably damaging 1.00
G1Funyon:Pkm UTSW 9 59668631 missense probably damaging 0.99
R0087:Pkm UTSW 9 59678099 nonsense probably null
R0603:Pkm UTSW 9 59665881 missense probably damaging 0.97
R0940:Pkm UTSW 9 59668535 splice site probably benign
R0990:Pkm UTSW 9 59678096 missense probably damaging 1.00
R1446:Pkm UTSW 9 59668910 splice site probably null
R5104:Pkm UTSW 9 59668681 critical splice donor site probably null
R5369:Pkm UTSW 9 59670634 missense probably damaging 1.00
R6831:Pkm UTSW 9 59675115 missense probably benign
R6974:Pkm UTSW 9 59668570 missense probably damaging 0.99
R7169:Pkm UTSW 9 59671625 missense possibly damaging 0.95
R7288:Pkm UTSW 9 59668913 missense probably benign 0.00
R7621:Pkm UTSW 9 59678158 nonsense probably null
R7844:Pkm UTSW 9 59670722 missense probably benign 0.00
R8217:Pkm UTSW 9 59678809 missense possibly damaging 0.74
R8234:Pkm UTSW 9 59670599 missense possibly damaging 0.87
R8313:Pkm UTSW 9 59668619 missense probably benign 0.04
R8977:Pkm UTSW 9 59671640 missense probably damaging 1.00
R9001:Pkm UTSW 9 59665343 missense probably benign 0.19
R9042:Pkm UTSW 9 59671937 missense probably damaging 1.00
Z1190:Pkm UTSW 9 59678070 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- TGGTGGCAGTATTCTGGAAC -3'
(R):5'- CGCTCAACTCTGGCTCAAAG -3'

Sequencing Primer
(F):5'- GCAGTATTCTGGAACTGTATGAGAG -3'
(R):5'- ACTCTGGCTCAAAGTCCAAAG -3'
Posted On 2020-07-28