Incidental Mutation 'R8301:Lrrc1'
ID 639268
Institutional Source Beutler Lab
Gene Symbol Lrrc1
Ensembl Gene ENSMUSG00000032352
Gene Name leucine rich repeat containing 1
Synonyms A430093J20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock # R8301 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 77430823-77544870 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 77544488 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 46 (N46Y)
Ref Sequence ENSEMBL: ENSMUSP00000139226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113421] [ENSMUST00000183734] [ENSMUST00000183873]
AlphaFold Q80VQ1
Predicted Effect probably benign
Transcript: ENSMUST00000113421
SMART Domains Protein: ENSMUSP00000109048
Gene: ENSMUSG00000032352

DomainStartEndE-ValueType
LRR 13 35 6.57e-1 SMART
LRR 36 59 1.12e2 SMART
LRR 82 104 2.15e2 SMART
LRR 105 127 3.09e1 SMART
LRR 128 150 2.14e0 SMART
LRR 151 173 3.02e0 SMART
LRR 174 196 3.47e0 SMART
LRR 197 219 6.58e0 SMART
LRR_TYP 220 243 4.72e-2 SMART
LRR 266 289 8.97e0 SMART
LRR 313 335 1.49e2 SMART
coiled coil region 440 461 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183734
AA Change: N46Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138912
Gene: ENSMUSG00000032352
AA Change: N46Y

DomainStartEndE-ValueType
LRR 36 57 3.18e1 SMART
LRR 58 80 6.57e-1 SMART
LRR 81 104 1.12e2 SMART
LRR 127 149 2.15e2 SMART
LRR 150 172 3.09e1 SMART
LRR 173 195 2.14e0 SMART
LRR 196 218 3.02e0 SMART
LRR 219 241 3.47e0 SMART
LRR 242 264 6.58e0 SMART
LRR_TYP 265 288 4.72e-2 SMART
LRR 289 311 8.03e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183873
AA Change: N46Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139226
Gene: ENSMUSG00000032352
AA Change: N46Y

DomainStartEndE-ValueType
LRR 36 57 3.18e1 SMART
LRR 58 80 6.57e-1 SMART
LRR 81 104 1.12e2 SMART
LRR 127 149 2.15e2 SMART
LRR 150 172 3.09e1 SMART
LRR 173 195 2.14e0 SMART
LRR 196 218 3.02e0 SMART
LRR 219 241 3.47e0 SMART
LRR 242 264 6.58e0 SMART
LRR_TYP 265 288 4.72e-2 SMART
LRR 311 334 8.97e0 SMART
LRR 358 380 1.49e2 SMART
coiled coil region 485 506 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,972,505 I374F probably benign Het
9430076C15Rik A G 6: 53,681,033 D116G possibly damaging Het
Ak9 G A 10: 41,424,716 V1108I Het
Aldh16a1 C T 7: 45,141,982 A790T possibly damaging Het
Anks1 A T 17: 28,059,580 probably benign Het
Antxr2 T G 5: 97,977,679 T240P probably benign Het
Arfgef1 A T 1: 10,179,833 M945K probably damaging Het
Arhgef17 T C 7: 100,879,659 T1591A probably benign Het
Aurka A G 2: 172,356,930 S374P probably damaging Het
Bccip T C 7: 133,719,204 S236P probably benign Het
Cacna1s T A 1: 136,073,441 probably benign Het
Calm1 A G 12: 100,205,685 E132G probably benign Het
Casz1 A G 4: 148,946,043 D1173G probably damaging Het
Cdh17 A G 4: 11,795,659 D413G probably damaging Het
Cfap57 A G 4: 118,593,074 I617T possibly damaging Het
Csnka2ip A C 16: 64,478,991 S337A unknown Het
Ddx60 A G 8: 62,000,597 E1250G probably benign Het
Dlgap2 T A 8: 14,823,577 S727T probably benign Het
Dpy19l1 T C 9: 24,485,111 probably benign Het
Ebf2 A G 14: 67,238,982 T134A possibly damaging Het
Echdc2 A T 4: 108,172,909 M136L probably benign Het
Enpp2 A G 15: 54,851,407 F598S probably benign Het
Extl3 A C 14: 65,076,284 L483R probably damaging Het
Gcat T C 15: 79,035,889 V227A possibly damaging Het
Hsf2 A G 10: 57,505,346 D344G probably damaging Het
Ighm C T 12: 113,421,545 G265D Het
Igsf9b T G 9: 27,334,739 probably benign Het
Ints6 A G 14: 62,702,453 V596A probably benign Het
Ints8 T C 4: 11,246,120 E182G probably damaging Het
Iqgap2 A G 13: 95,682,151 probably null Het
Kalrn G T 16: 34,357,100 Q250K probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naa50 A G 16: 44,157,131 N74S probably benign Het
Neb T C 2: 52,288,835 N1303S probably benign Het
Nfs1 A T 2: 156,134,493 C160* probably null Het
Olfr472 A G 7: 107,903,626 K303R probably benign Het
Olfr591 T G 7: 103,173,073 K188T probably damaging Het
Olfr740 T A 14: 50,453,564 S171T probably benign Het
Olfr809 T C 10: 129,776,840 S309P probably benign Het
Orm2 T C 4: 63,363,026 F67S possibly damaging Het
Pex5 A G 6: 124,405,183 S180P probably benign Het
Phf14 G C 6: 11,992,062 G746R probably damaging Het
Pkm T A 9: 59,668,631 V110E probably damaging Het
Plekha6 T G 1: 133,264,687 N78K probably damaging Het
Plxna2 G A 1: 194,790,175 V1076I probably benign Het
Polq C A 16: 37,061,819 D1448E probably damaging Het
Pot1b T C 17: 55,687,895 T256A probably benign Het
Prkch C T 12: 73,702,764 T377I possibly damaging Het
Prl3c1 A C 13: 27,199,185 probably benign Het
Prl7b1 A C 13: 27,602,772 V158G possibly damaging Het
Prss22 T C 17: 23,993,981 S261G probably damaging Het
Psd T C 19: 46,321,102 probably benign Het
Psg18 A T 7: 18,353,377 Y119N probably damaging Het
Rbm6 T G 9: 107,852,794 R218S probably damaging Het
Rnf213 T A 11: 119,434,742 S1491T Het
Rsf1 T C 7: 97,661,925 S621P Het
Runx1 C A 16: 92,605,656 *466L probably null Het
Samd4 A G 14: 47,016,678 I200V probably benign Het
Sdsl C T 5: 120,459,519 C241Y probably benign Het
Sepn1 T C 4: 134,551,414 probably benign Het
Setx C T 2: 29,145,690 P729L possibly damaging Het
Sf1 C T 19: 6,368,366 Q55* probably null Het
Slc12a5 A T 2: 164,993,691 N833I probably damaging Het
Slc1a4 T C 11: 20,332,286 R63G probably damaging Het
Tmeff2 G T 1: 51,181,837 A324S probably benign Het
Tmem217 A G 17: 29,526,492 I88T possibly damaging Het
Tnfsf8 A T 4: 63,860,878 I61N probably benign Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trhde T A 10: 114,487,006 E667V probably benign Het
Unc13b A G 4: 43,263,568 T1598A probably benign Het
Vmn2r73 A T 7: 85,858,302 C601S probably benign Het
Zfp873 C A 10: 82,060,879 H481Q probably damaging Het
Other mutations in Lrrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02556:Lrrc1 APN 9 77435122 missense probably benign 0.00
IGL02975:Lrrc1 APN 9 77452647 missense probably damaging 1.00
IGL03063:Lrrc1 APN 9 77499269 missense probably damaging 0.99
G1Funyon:Lrrc1 UTSW 9 77544488 missense probably damaging 1.00
R0610:Lrrc1 UTSW 9 77472206 missense possibly damaging 0.95
R1462:Lrrc1 UTSW 9 77442265 missense probably benign 0.01
R1462:Lrrc1 UTSW 9 77442265 missense probably benign 0.01
R1615:Lrrc1 UTSW 9 77435118 missense possibly damaging 0.94
R2932:Lrrc1 UTSW 9 77457439 missense probably benign 0.01
R5087:Lrrc1 UTSW 9 77457458 missense probably benign
R5907:Lrrc1 UTSW 9 77434097 missense probably damaging 0.99
R6443:Lrrc1 UTSW 9 77434032 missense probably damaging 1.00
R6502:Lrrc1 UTSW 9 77442191 missense probably damaging 1.00
R7073:Lrrc1 UTSW 9 77468565 missense probably benign 0.04
R7162:Lrrc1 UTSW 9 77432190 missense probably benign 0.13
R7177:Lrrc1 UTSW 9 77472222 nonsense probably null
R7290:Lrrc1 UTSW 9 77457839 missense probably benign 0.01
R7885:Lrrc1 UTSW 9 77442189 missense probably damaging 0.97
R8375:Lrrc1 UTSW 9 77457847 missense probably damaging 1.00
R8945:Lrrc1 UTSW 9 77435091 missense probably damaging 1.00
R9188:Lrrc1 UTSW 9 77455205 missense probably benign 0.42
R9225:Lrrc1 UTSW 9 77452673 missense probably benign 0.00
R9336:Lrrc1 UTSW 9 77442198 missense probably damaging 1.00
RF020:Lrrc1 UTSW 9 77452631 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGTTTCTCCACTAGCCATGTAAC -3'
(R):5'- TTCCTCAGAACGTTCGGGAC -3'

Sequencing Primer
(F):5'- TCCACTAGCCATGTAACTACTTG -3'
(R):5'- AGCTTGGAGCCAGCAAC -3'
Posted On 2020-07-28