Incidental Mutation 'R8301:Zfp873'
ID 639272
Institutional Source Beutler Lab
Gene Symbol Zfp873
Ensembl Gene ENSMUSG00000061371
Gene Name zinc finger protein 873
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock # R8301 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 82048123-82064745 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 82060879 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 481 (H481Q)
Ref Sequence ENSEMBL: ENSMUSP00000100950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105313] [ENSMUST00000209622] [ENSMUST00000210325]
AlphaFold A0A1B0GT64
Predicted Effect probably damaging
Transcript: ENSMUST00000105313
AA Change: H481Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100950
Gene: ENSMUSG00000061371
AA Change: H481Q

DomainStartEndE-ValueType
ZnF_C2H2 68 90 1.12e2 SMART
ZnF_C2H2 96 117 4.69e0 SMART
ZnF_C2H2 123 145 2.06e1 SMART
ZnF_C2H2 151 173 5.5e-3 SMART
ZnF_C2H2 179 201 3.69e-4 SMART
ZnF_C2H2 207 229 3.89e-3 SMART
ZnF_C2H2 235 257 9.88e-5 SMART
ZnF_C2H2 263 285 5.59e-4 SMART
ZnF_C2H2 291 313 2.99e-4 SMART
ZnF_C2H2 319 341 1.95e-3 SMART
ZnF_C2H2 347 369 2.75e-3 SMART
ZnF_C2H2 375 397 7.37e-4 SMART
ZnF_C2H2 403 425 2.53e-2 SMART
ZnF_C2H2 431 453 9.08e-4 SMART
ZnF_C2H2 459 481 5.99e-4 SMART
ZnF_C2H2 487 509 1.22e-4 SMART
ZnF_C2H2 515 537 1.82e-3 SMART
ZnF_C2H2 543 565 2.53e-2 SMART
ZnF_C2H2 571 593 9.73e-4 SMART
ZnF_C2H2 599 619 3.13e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209622
Predicted Effect probably damaging
Transcript: ENSMUST00000210325
AA Change: H518Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,972,505 I374F probably benign Het
9430076C15Rik A G 6: 53,681,033 D116G possibly damaging Het
Ak9 G A 10: 41,424,716 V1108I Het
Aldh16a1 C T 7: 45,141,982 A790T possibly damaging Het
Anks1 A T 17: 28,059,580 probably benign Het
Antxr2 T G 5: 97,977,679 T240P probably benign Het
Arfgef1 A T 1: 10,179,833 M945K probably damaging Het
Arhgef17 T C 7: 100,879,659 T1591A probably benign Het
Aurka A G 2: 172,356,930 S374P probably damaging Het
Bccip T C 7: 133,719,204 S236P probably benign Het
Cacna1s T A 1: 136,073,441 probably benign Het
Calm1 A G 12: 100,205,685 E132G probably benign Het
Casz1 A G 4: 148,946,043 D1173G probably damaging Het
Cdh17 A G 4: 11,795,659 D413G probably damaging Het
Cfap57 A G 4: 118,593,074 I617T possibly damaging Het
Csnka2ip A C 16: 64,478,991 S337A unknown Het
Ddx60 A G 8: 62,000,597 E1250G probably benign Het
Dlgap2 T A 8: 14,823,577 S727T probably benign Het
Dpy19l1 T C 9: 24,485,111 probably benign Het
Ebf2 A G 14: 67,238,982 T134A possibly damaging Het
Echdc2 A T 4: 108,172,909 M136L probably benign Het
Enpp2 A G 15: 54,851,407 F598S probably benign Het
Extl3 A C 14: 65,076,284 L483R probably damaging Het
Gcat T C 15: 79,035,889 V227A possibly damaging Het
Hsf2 A G 10: 57,505,346 D344G probably damaging Het
Ighm C T 12: 113,421,545 G265D Het
Igsf9b T G 9: 27,334,739 probably benign Het
Ints6 A G 14: 62,702,453 V596A probably benign Het
Ints8 T C 4: 11,246,120 E182G probably damaging Het
Iqgap2 A G 13: 95,682,151 probably null Het
Kalrn G T 16: 34,357,100 Q250K probably benign Het
Lrrc1 T A 9: 77,544,488 N46Y probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naa50 A G 16: 44,157,131 N74S probably benign Het
Neb T C 2: 52,288,835 N1303S probably benign Het
Nfs1 A T 2: 156,134,493 C160* probably null Het
Olfr472 A G 7: 107,903,626 K303R probably benign Het
Olfr591 T G 7: 103,173,073 K188T probably damaging Het
Olfr740 T A 14: 50,453,564 S171T probably benign Het
Olfr809 T C 10: 129,776,840 S309P probably benign Het
Orm2 T C 4: 63,363,026 F67S possibly damaging Het
Pex5 A G 6: 124,405,183 S180P probably benign Het
Phf14 G C 6: 11,992,062 G746R probably damaging Het
Pkm T A 9: 59,668,631 V110E probably damaging Het
Plekha6 T G 1: 133,264,687 N78K probably damaging Het
Plxna2 G A 1: 194,790,175 V1076I probably benign Het
Polq C A 16: 37,061,819 D1448E probably damaging Het
Pot1b T C 17: 55,687,895 T256A probably benign Het
Prkch C T 12: 73,702,764 T377I possibly damaging Het
Prl3c1 A C 13: 27,199,185 probably benign Het
Prl7b1 A C 13: 27,602,772 V158G possibly damaging Het
Prss22 T C 17: 23,993,981 S261G probably damaging Het
Psd T C 19: 46,321,102 probably benign Het
Psg18 A T 7: 18,353,377 Y119N probably damaging Het
Rbm6 T G 9: 107,852,794 R218S probably damaging Het
Rnf213 T A 11: 119,434,742 S1491T Het
Rsf1 T C 7: 97,661,925 S621P Het
Runx1 C A 16: 92,605,656 *466L probably null Het
Samd4 A G 14: 47,016,678 I200V probably benign Het
Sdsl C T 5: 120,459,519 C241Y probably benign Het
Sepn1 T C 4: 134,551,414 probably benign Het
Setx C T 2: 29,145,690 P729L possibly damaging Het
Sf1 C T 19: 6,368,366 Q55* probably null Het
Slc12a5 A T 2: 164,993,691 N833I probably damaging Het
Slc1a4 T C 11: 20,332,286 R63G probably damaging Het
Tmeff2 G T 1: 51,181,837 A324S probably benign Het
Tmem217 A G 17: 29,526,492 I88T possibly damaging Het
Tnfsf8 A T 4: 63,860,878 I61N probably benign Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trhde T A 10: 114,487,006 E667V probably benign Het
Unc13b A G 4: 43,263,568 T1598A probably benign Het
Vmn2r73 A T 7: 85,858,302 C601S probably benign Het
Other mutations in Zfp873
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02250:Zfp873 APN 10 82058418 start codon destroyed probably null 0.45
G1Funyon:Zfp873 UTSW 10 82060879 missense probably damaging 1.00
R0666:Zfp873 UTSW 10 82060761 missense possibly damaging 0.75
R1568:Zfp873 UTSW 10 82060279 missense probably damaging 1.00
R1739:Zfp873 UTSW 10 82060707 missense probably damaging 1.00
R1848:Zfp873 UTSW 10 82060572 missense probably benign 0.33
R1892:Zfp873 UTSW 10 82061246 missense probably damaging 1.00
R2061:Zfp873 UTSW 10 82060157 missense probably benign 0.01
R3735:Zfp873 UTSW 10 82061181 missense probably benign 0.15
R4422:Zfp873 UTSW 10 82060874 missense probably benign 0.13
R4674:Zfp873 UTSW 10 82059980 missense possibly damaging 0.53
R4839:Zfp873 UTSW 10 82060519 missense probably damaging 0.98
R5146:Zfp873 UTSW 10 82060224 missense probably damaging 1.00
R5154:Zfp873 UTSW 10 82060191 missense possibly damaging 0.54
R5160:Zfp873 UTSW 10 82061042 missense possibly damaging 0.54
R5811:Zfp873 UTSW 10 82060733 missense probably damaging 1.00
R6625:Zfp873 UTSW 10 82060304 missense probably damaging 1.00
R6667:Zfp873 UTSW 10 82060589 missense probably benign 0.22
R6742:Zfp873 UTSW 10 82058422 missense probably damaging 1.00
R6878:Zfp873 UTSW 10 82060695 missense probably benign 0.33
R7055:Zfp873 UTSW 10 82059998 missense probably damaging 1.00
R7296:Zfp873 UTSW 10 82061237 missense probably damaging 1.00
R7381:Zfp873 UTSW 10 82060971 missense probably damaging 1.00
R7448:Zfp873 UTSW 10 82060627 missense probably damaging 1.00
R7464:Zfp873 UTSW 10 82060376 missense possibly damaging 0.51
R7470:Zfp873 UTSW 10 82059939 missense probably benign 0.19
R7640:Zfp873 UTSW 10 82060275 missense possibly damaging 0.72
R7862:Zfp873 UTSW 10 82060275 missense probably benign 0.03
R8017:Zfp873 UTSW 10 82060359 missense probably benign 0.01
R8765:Zfp873 UTSW 10 82060238 missense probably damaging 1.00
R8997:Zfp873 UTSW 10 82061156 missense probably benign 0.03
R9305:Zfp873 UTSW 10 82060680 missense probably benign 0.00
Z1177:Zfp873 UTSW 10 82061165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACACTGGAGAGAAGCCCT -3'
(R):5'- GGGTTTCTCTCCAGCACAGAATT -3'

Sequencing Primer
(F):5'- CCCTATGCATGCAATCAGTGTGG -3'
(R):5'- GCGAAGTGCAAAGCCTTTAC -3'
Posted On 2020-07-28