Incidental Mutation 'R8301:Trhde'
ID 639273
Institutional Source Beutler Lab
Gene Symbol Trhde
Ensembl Gene ENSMUSG00000050663
Gene Name TRH-degrading enzyme
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock # R8301 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 114398823-114802307 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 114487006 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 667 (E667V)
Ref Sequence ENSEMBL: ENSMUSP00000057449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061632]
AlphaFold Q8K093
Predicted Effect probably benign
Transcript: ENSMUST00000061632
AA Change: E667V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000057449
Gene: ENSMUSG00000050663
AA Change: E667V

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
Pfam:Peptidase_M1 141 531 2.6e-141 PFAM
Pfam:ERAP1_C 679 1004 5.7e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase M1 family. The encoded protein is an extracellular peptidase that specifically cleaves and inactivates the neuropeptide thyrotropin-releasing hormone.[provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,972,505 I374F probably benign Het
9430076C15Rik A G 6: 53,681,033 D116G possibly damaging Het
Ak9 G A 10: 41,424,716 V1108I Het
Aldh16a1 C T 7: 45,141,982 A790T possibly damaging Het
Anks1 A T 17: 28,059,580 probably benign Het
Antxr2 T G 5: 97,977,679 T240P probably benign Het
Arfgef1 A T 1: 10,179,833 M945K probably damaging Het
Arhgef17 T C 7: 100,879,659 T1591A probably benign Het
Aurka A G 2: 172,356,930 S374P probably damaging Het
Bccip T C 7: 133,719,204 S236P probably benign Het
Cacna1s T A 1: 136,073,441 probably benign Het
Calm1 A G 12: 100,205,685 E132G probably benign Het
Casz1 A G 4: 148,946,043 D1173G probably damaging Het
Cdh17 A G 4: 11,795,659 D413G probably damaging Het
Cfap57 A G 4: 118,593,074 I617T possibly damaging Het
Csnka2ip A C 16: 64,478,991 S337A unknown Het
Ddx60 A G 8: 62,000,597 E1250G probably benign Het
Dlgap2 T A 8: 14,823,577 S727T probably benign Het
Dpy19l1 T C 9: 24,485,111 probably benign Het
Ebf2 A G 14: 67,238,982 T134A possibly damaging Het
Echdc2 A T 4: 108,172,909 M136L probably benign Het
Enpp2 A G 15: 54,851,407 F598S probably benign Het
Extl3 A C 14: 65,076,284 L483R probably damaging Het
Gcat T C 15: 79,035,889 V227A possibly damaging Het
Hsf2 A G 10: 57,505,346 D344G probably damaging Het
Ighm C T 12: 113,421,545 G265D Het
Igsf9b T G 9: 27,334,739 probably benign Het
Ints6 A G 14: 62,702,453 V596A probably benign Het
Ints8 T C 4: 11,246,120 E182G probably damaging Het
Iqgap2 A G 13: 95,682,151 probably null Het
Kalrn G T 16: 34,357,100 Q250K probably benign Het
Lrrc1 T A 9: 77,544,488 N46Y probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naa50 A G 16: 44,157,131 N74S probably benign Het
Neb T C 2: 52,288,835 N1303S probably benign Het
Nfs1 A T 2: 156,134,493 C160* probably null Het
Olfr472 A G 7: 107,903,626 K303R probably benign Het
Olfr591 T G 7: 103,173,073 K188T probably damaging Het
Olfr740 T A 14: 50,453,564 S171T probably benign Het
Olfr809 T C 10: 129,776,840 S309P probably benign Het
Orm2 T C 4: 63,363,026 F67S possibly damaging Het
Pex5 A G 6: 124,405,183 S180P probably benign Het
Phf14 G C 6: 11,992,062 G746R probably damaging Het
Pkm T A 9: 59,668,631 V110E probably damaging Het
Plekha6 T G 1: 133,264,687 N78K probably damaging Het
Plxna2 G A 1: 194,790,175 V1076I probably benign Het
Polq C A 16: 37,061,819 D1448E probably damaging Het
Pot1b T C 17: 55,687,895 T256A probably benign Het
Prkch C T 12: 73,702,764 T377I possibly damaging Het
Prl3c1 A C 13: 27,199,185 probably benign Het
Prl7b1 A C 13: 27,602,772 V158G possibly damaging Het
Prss22 T C 17: 23,993,981 S261G probably damaging Het
Psd T C 19: 46,321,102 probably benign Het
Psg18 A T 7: 18,353,377 Y119N probably damaging Het
Rbm6 T G 9: 107,852,794 R218S probably damaging Het
Rnf213 T A 11: 119,434,742 S1491T Het
Rsf1 T C 7: 97,661,925 S621P Het
Runx1 C A 16: 92,605,656 *466L probably null Het
Samd4 A G 14: 47,016,678 I200V probably benign Het
Sdsl C T 5: 120,459,519 C241Y probably benign Het
Sepn1 T C 4: 134,551,414 probably benign Het
Setx C T 2: 29,145,690 P729L possibly damaging Het
Sf1 C T 19: 6,368,366 Q55* probably null Het
Slc12a5 A T 2: 164,993,691 N833I probably damaging Het
Slc1a4 T C 11: 20,332,286 R63G probably damaging Het
Tmeff2 G T 1: 51,181,837 A324S probably benign Het
Tmem217 A G 17: 29,526,492 I88T possibly damaging Het
Tnfsf8 A T 4: 63,860,878 I61N probably benign Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Unc13b A G 4: 43,263,568 T1598A probably benign Het
Vmn2r73 A T 7: 85,858,302 C601S probably benign Het
Zfp873 C A 10: 82,060,879 H481Q probably damaging Het
Other mutations in Trhde
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Trhde APN 10 114486747 missense possibly damaging 0.77
IGL00516:Trhde APN 10 114446199 missense probably benign 0.01
IGL01371:Trhde APN 10 114588500 missense possibly damaging 0.57
IGL01488:Trhde APN 10 114446158 missense possibly damaging 0.58
IGL01602:Trhde APN 10 114787943 missense probably benign
IGL01605:Trhde APN 10 114787943 missense probably benign
IGL02150:Trhde APN 10 114592108 missense probably damaging 1.00
IGL02165:Trhde APN 10 114592161 missense probably damaging 1.00
IGL02340:Trhde APN 10 114592213 splice site probably benign
IGL02412:Trhde APN 10 114486925 missense probably damaging 1.00
IGL02421:Trhde APN 10 114412461 missense probably damaging 1.00
IGL02496:Trhde APN 10 114800561 nonsense probably null
IGL02952:Trhde APN 10 114800573 missense probably damaging 0.99
IGL03197:Trhde APN 10 114413308 missense probably benign 0.00
Cata UTSW 10 114592066 missense probably damaging 1.00
l3-37 UTSW 10 114801081 missense probably benign
Pelte UTSW 10 114486704 critical splice donor site probably null
G1Funyon:Trhde UTSW 10 114487006 missense probably benign 0.03
R0360:Trhde UTSW 10 114502982 splice site probably benign
R0364:Trhde UTSW 10 114502982 splice site probably benign
R0457:Trhde UTSW 10 114448262 missense probably benign 0.37
R0589:Trhde UTSW 10 114448324 missense probably benign 0.01
R1132:Trhde UTSW 10 114412478 missense possibly damaging 0.86
R1288:Trhde UTSW 10 114801290 missense probably benign 0.37
R1569:Trhde UTSW 10 114446188 missense possibly damaging 0.78
R1776:Trhde UTSW 10 114800603 missense probably benign 0.06
R1781:Trhde UTSW 10 114588500 missense possibly damaging 0.57
R1927:Trhde UTSW 10 114800849 missense probably damaging 1.00
R1976:Trhde UTSW 10 114588431 missense possibly damaging 0.57
R2011:Trhde UTSW 10 114498793 missense probably benign 0.02
R2332:Trhde UTSW 10 114592165 missense probably damaging 1.00
R2356:Trhde UTSW 10 114401516 missense probably damaging 1.00
R3107:Trhde UTSW 10 114592066 missense probably damaging 1.00
R3108:Trhde UTSW 10 114592066 missense probably damaging 1.00
R3907:Trhde UTSW 10 114800696 missense possibly damaging 0.72
R4067:Trhde UTSW 10 114444680 nonsense probably null
R4214:Trhde UTSW 10 114788070 missense possibly damaging 0.51
R4428:Trhde UTSW 10 114503123 missense probably damaging 1.00
R4429:Trhde UTSW 10 114503123 missense probably damaging 1.00
R4430:Trhde UTSW 10 114503123 missense probably damaging 1.00
R5244:Trhde UTSW 10 114801081 missense probably benign
R5456:Trhde UTSW 10 114486760 missense possibly damaging 0.58
R5540:Trhde UTSW 10 114800592 missense probably benign 0.45
R5699:Trhde UTSW 10 114588502 missense probably benign 0.00
R5967:Trhde UTSW 10 114567134 missense probably damaging 1.00
R6326:Trhde UTSW 10 114567224 missense probably damaging 1.00
R6467:Trhde UTSW 10 114504198 missense probably damaging 1.00
R7028:Trhde UTSW 10 114518177 missense probably damaging 1.00
R7264:Trhde UTSW 10 114800871 missense possibly damaging 0.93
R7266:Trhde UTSW 10 114800871 missense possibly damaging 0.93
R7310:Trhde UTSW 10 114800573 missense probably damaging 0.99
R7460:Trhde UTSW 10 114413263 missense probably damaging 1.00
R7732:Trhde UTSW 10 114788064 missense probably benign
R7842:Trhde UTSW 10 114696098 missense possibly damaging 0.86
R8178:Trhde UTSW 10 114408693 missense possibly damaging 0.93
R8209:Trhde UTSW 10 114567228 missense probably damaging 1.00
R8226:Trhde UTSW 10 114567228 missense probably damaging 1.00
R8232:Trhde UTSW 10 114800537 missense possibly damaging 0.90
R8312:Trhde UTSW 10 114413287 missense probably damaging 1.00
R8335:Trhde UTSW 10 114486704 critical splice donor site probably null
R8477:Trhde UTSW 10 114800717 missense probably benign 0.02
R8853:Trhde UTSW 10 114800925 missense probably benign
R8953:Trhde UTSW 10 114503061 missense probably damaging 0.98
R9375:Trhde UTSW 10 114408693 missense probably damaging 0.99
Z1177:Trhde UTSW 10 114448389 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGCCAAACAGACAACGGATG -3'
(R):5'- TTAACAGCCATGCGAACATAGTG -3'

Sequencing Primer
(F):5'- CGGATGAGTAGATCAAGGATGTACC -3'
(R):5'- CCATGCGAACATAGTGGGGTAATTC -3'
Posted On 2020-07-28