Incidental Mutation 'R8301:Olfr809'
ID639274
Institutional Source Beutler Lab
Gene Symbol Olfr809
Ensembl Gene ENSMUSG00000050251
Gene Nameolfactory receptor 809
SynonymsMOR108-4, GA_x6K02T2PULF-11454600-11455541
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R8301 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location129774638-129778937 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129776840 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 309 (S309P)
Ref Sequence ENSEMBL: ENSMUSP00000054949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059891] [ENSMUST00000203598] [ENSMUST00000204622]
Predicted Effect probably benign
Transcript: ENSMUST00000059891
AA Change: S309P

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000054949
Gene: ENSMUSG00000050251
AA Change: S309P

DomainStartEndE-ValueType
Pfam:7tm_4 44 321 3.5e-49 PFAM
Pfam:7tm_1 54 303 1.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203598
SMART Domains Protein: ENSMUSP00000145037
Gene: ENSMUSG00000050251

DomainStartEndE-ValueType
Pfam:7tm_4 29 148 8.1e-20 PFAM
Pfam:7tm_1 39 149 1.8e-17 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000145260
Gene: ENSMUSG00000052818
AA Change: S324P

DomainStartEndE-ValueType
Pfam:7tm_4 44 321 3.5e-49 PFAM
Pfam:7tm_1 54 303 1.3e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,972,505 I374F probably benign Het
9430076C15Rik A G 6: 53,681,033 D116G possibly damaging Het
Ak9 G A 10: 41,424,716 V1108I Het
Aldh16a1 C T 7: 45,141,982 A790T possibly damaging Het
Antxr2 T G 5: 97,977,679 T240P probably benign Het
Arfgef1 A T 1: 10,179,833 M945K probably damaging Het
Arhgef17 T C 7: 100,879,659 T1591A probably benign Het
Aurka A G 2: 172,356,930 S374P probably damaging Het
Bccip T C 7: 133,719,204 S236P probably benign Het
Calm1 A G 12: 100,205,685 E132G probably benign Het
Casz1 A G 4: 148,946,043 D1173G probably damaging Het
Cdh17 A G 4: 11,795,659 D413G probably damaging Het
Cfap57 A G 4: 118,593,074 I617T possibly damaging Het
Csnka2ip A C 16: 64,478,991 S337A unknown Het
Ddx60 A G 8: 62,000,597 E1250G probably benign Het
Dlgap2 T A 8: 14,823,577 S727T probably benign Het
Ebf2 A G 14: 67,238,982 T134A possibly damaging Het
Echdc2 A T 4: 108,172,909 M136L probably benign Het
Enpp2 A G 15: 54,851,407 F598S probably benign Het
Extl3 A C 14: 65,076,284 L483R probably damaging Het
Gcat T C 15: 79,035,889 V227A possibly damaging Het
Hsf2 A G 10: 57,505,346 D344G probably damaging Het
Ighm C T 12: 113,421,545 G265D Het
Ints6 A G 14: 62,702,453 V596A probably benign Het
Ints8 T C 4: 11,246,120 E182G probably damaging Het
Iqgap2 A G 13: 95,682,151 probably null Het
Kalrn G T 16: 34,357,100 Q250K probably benign Het
Lrrc1 T A 9: 77,544,488 N46Y probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naa50 A G 16: 44,157,131 N74S probably benign Het
Neb T C 2: 52,288,835 N1303S probably benign Het
Nfs1 A T 2: 156,134,493 C160* probably null Het
Olfr472 A G 7: 107,903,626 K303R probably benign Het
Olfr591 T G 7: 103,173,073 K188T probably damaging Het
Olfr740 T A 14: 50,453,564 S171T probably benign Het
Orm2 T C 4: 63,363,026 F67S possibly damaging Het
Pex5 A G 6: 124,405,183 S180P probably benign Het
Phf14 G C 6: 11,992,062 G746R probably damaging Het
Pkm T A 9: 59,668,631 V110E probably damaging Het
Plekha6 T G 1: 133,264,687 N78K probably damaging Het
Plxna2 G A 1: 194,790,175 V1076I probably benign Het
Polq C A 16: 37,061,819 D1448E probably damaging Het
Pot1b T C 17: 55,687,895 T256A probably benign Het
Prkch C T 12: 73,702,764 T377I possibly damaging Het
Prl7b1 A C 13: 27,602,772 V158G possibly damaging Het
Prss22 T C 17: 23,993,981 S261G probably damaging Het
Psg18 A T 7: 18,353,377 Y119N probably damaging Het
Rbm6 T G 9: 107,852,794 R218S probably damaging Het
Rnf213 T A 11: 119,434,742 S1491T Het
Rsf1 T C 7: 97,661,925 S621P Het
Runx1 C A 16: 92,605,656 *466L probably null Het
Samd4 A G 14: 47,016,678 I200V probably benign Het
Sdsl C T 5: 120,459,519 C241Y probably benign Het
Setx C T 2: 29,145,690 P729L possibly damaging Het
Sf1 C T 19: 6,368,366 Q55* probably null Het
Slc12a5 A T 2: 164,993,691 N833I probably damaging Het
Slc1a4 T C 11: 20,332,286 R63G probably damaging Het
Tmeff2 G T 1: 51,181,837 A324S probably benign Het
Tmem217 A G 17: 29,526,492 I88T possibly damaging Het
Tnfsf8 A T 4: 63,860,878 I61N probably benign Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trhde T A 10: 114,487,006 E667V probably benign Het
Unc13b A G 4: 43,263,568 T1598A probably benign Het
Vmn2r73 A T 7: 85,858,302 C601S probably benign Het
Zfp873 C A 10: 82,060,879 H481Q probably damaging Het
Other mutations in Olfr809
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01884:Olfr809 APN 10 129776828 missense probably benign 0.34
IGL02000:Olfr809 APN 10 129776069 missense probably benign 0.03
IGL02146:Olfr809 APN 10 129776858 utr 3 prime probably benign
IGL03087:Olfr809 APN 10 129776261 missense probably damaging 0.98
IGL03260:Olfr809 APN 10 129776652 missense probably damaging 1.00
PIT4466001:Olfr809 UTSW 10 129776273 missense probably benign 0.04
R0564:Olfr809 UTSW 10 129776136 missense probably damaging 1.00
R0613:Olfr809 UTSW 10 129776262 missense probably damaging 1.00
R1165:Olfr809 UTSW 10 129776433 missense probably damaging 0.99
R1556:Olfr809 UTSW 10 129776373 missense probably benign 0.05
R5392:Olfr809 UTSW 10 129776315 missense probably benign 0.01
R6665:Olfr809 UTSW 10 129776247 missense probably damaging 1.00
R7519:Olfr809 UTSW 10 129776222 missense probably benign 0.01
R7804:Olfr809 UTSW 10 129776222 missense probably benign 0.01
R8022:Olfr809 UTSW 10 129776785 missense possibly damaging 0.47
R8447:Olfr809 UTSW 10 129776502 missense possibly damaging 0.89
Z1176:Olfr809 UTSW 10 129776042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAAGCTGCATCTTCATGTATG -3'
(R):5'- GGCTCAATGACTTAACCTTTCC -3'

Sequencing Primer
(F):5'- TATGTGAAAACATCTGCCAAGGCTG -3'
(R):5'- CCTTTCCAAAAATATGCATGATGTC -3'
Posted On2020-07-28