Incidental Mutation 'R8301:Slc1a4'
ID639275
Institutional Source Beutler Lab
Gene Symbol Slc1a4
Ensembl Gene ENSMUSG00000020142
Gene Namesolute carrier family 1 (glutamate/neutral amino acid transporter), member 4
SynonymsASCT1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8301 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location20302180-20332713 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20332286 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 63 (R63G)
Ref Sequence ENSEMBL: ENSMUSP00000105223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004634] [ENSMUST00000109594]
Predicted Effect probably benign
Transcript: ENSMUST00000004634
SMART Domains Protein: ENSMUSP00000004634
Gene: ENSMUSG00000020142

DomainStartEndE-ValueType
Pfam:SDF 1 397 2.7e-121 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109594
AA Change: R63G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105223
Gene: ENSMUSG00000020142
AA Change: R63G

DomainStartEndE-ValueType
Pfam:SDF 44 477 4.2e-121 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-dependent neutral amino acid transporter for alanine, serine, cysteine, and threonine. Defects in this gene have been associated with developmental delay, microcephaly, and intellectual disability. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,972,505 I374F probably benign Het
9430076C15Rik A G 6: 53,681,033 D116G possibly damaging Het
Ak9 G A 10: 41,424,716 V1108I Het
Aldh16a1 C T 7: 45,141,982 A790T possibly damaging Het
Antxr2 T G 5: 97,977,679 T240P probably benign Het
Arfgef1 A T 1: 10,179,833 M945K probably damaging Het
Arhgef17 T C 7: 100,879,659 T1591A probably benign Het
Aurka A G 2: 172,356,930 S374P probably damaging Het
Bccip T C 7: 133,719,204 S236P probably benign Het
Calm1 A G 12: 100,205,685 E132G probably benign Het
Casz1 A G 4: 148,946,043 D1173G probably damaging Het
Cdh17 A G 4: 11,795,659 D413G probably damaging Het
Cfap57 A G 4: 118,593,074 I617T possibly damaging Het
Csnka2ip A C 16: 64,478,991 S337A unknown Het
Ddx60 A G 8: 62,000,597 E1250G probably benign Het
Dlgap2 T A 8: 14,823,577 S727T probably benign Het
Ebf2 A G 14: 67,238,982 T134A possibly damaging Het
Echdc2 A T 4: 108,172,909 M136L probably benign Het
Enpp2 A G 15: 54,851,407 F598S probably benign Het
Extl3 A C 14: 65,076,284 L483R probably damaging Het
Gcat T C 15: 79,035,889 V227A possibly damaging Het
Hsf2 A G 10: 57,505,346 D344G probably damaging Het
Ighm C T 12: 113,421,545 G265D Het
Ints6 A G 14: 62,702,453 V596A probably benign Het
Ints8 T C 4: 11,246,120 E182G probably damaging Het
Iqgap2 A G 13: 95,682,151 probably null Het
Kalrn G T 16: 34,357,100 Q250K probably benign Het
Lrrc1 T A 9: 77,544,488 N46Y probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naa50 A G 16: 44,157,131 N74S probably benign Het
Neb T C 2: 52,288,835 N1303S probably benign Het
Nfs1 A T 2: 156,134,493 C160* probably null Het
Olfr472 A G 7: 107,903,626 K303R probably benign Het
Olfr591 T G 7: 103,173,073 K188T probably damaging Het
Olfr740 T A 14: 50,453,564 S171T probably benign Het
Olfr809 T C 10: 129,776,840 S309P probably benign Het
Orm2 T C 4: 63,363,026 F67S possibly damaging Het
Pex5 A G 6: 124,405,183 S180P probably benign Het
Phf14 G C 6: 11,992,062 G746R probably damaging Het
Pkm T A 9: 59,668,631 V110E probably damaging Het
Plekha6 T G 1: 133,264,687 N78K probably damaging Het
Plxna2 G A 1: 194,790,175 V1076I probably benign Het
Polq C A 16: 37,061,819 D1448E probably damaging Het
Pot1b T C 17: 55,687,895 T256A probably benign Het
Prkch C T 12: 73,702,764 T377I possibly damaging Het
Prl7b1 A C 13: 27,602,772 V158G possibly damaging Het
Prss22 T C 17: 23,993,981 S261G probably damaging Het
Psg18 A T 7: 18,353,377 Y119N probably damaging Het
Rbm6 T G 9: 107,852,794 R218S probably damaging Het
Rnf213 T A 11: 119,434,742 S1491T Het
Rsf1 T C 7: 97,661,925 S621P Het
Runx1 C A 16: 92,605,656 *466L probably null Het
Samd4 A G 14: 47,016,678 I200V probably benign Het
Sdsl C T 5: 120,459,519 C241Y probably benign Het
Setx C T 2: 29,145,690 P729L possibly damaging Het
Sf1 C T 19: 6,368,366 Q55* probably null Het
Slc12a5 A T 2: 164,993,691 N833I probably damaging Het
Tmeff2 G T 1: 51,181,837 A324S probably benign Het
Tmem217 A G 17: 29,526,492 I88T possibly damaging Het
Tnfsf8 A T 4: 63,860,878 I61N probably benign Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trhde T A 10: 114,487,006 E667V probably benign Het
Unc13b A G 4: 43,263,568 T1598A probably benign Het
Vmn2r73 A T 7: 85,858,302 C601S probably benign Het
Zfp873 C A 10: 82,060,879 H481Q probably damaging Het
Other mutations in Slc1a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Slc1a4 APN 11 20308644 splice site probably benign
IGL01889:Slc1a4 APN 11 20314089 splice site probably benign
IGL02725:Slc1a4 APN 11 20308408 missense probably damaging 1.00
IGL03409:Slc1a4 APN 11 20306506 missense probably damaging 1.00
R0085:Slc1a4 UTSW 11 20304510 splice site probably benign
R0771:Slc1a4 UTSW 11 20306467 missense probably damaging 1.00
R0898:Slc1a4 UTSW 11 20304349 missense probably damaging 1.00
R1326:Slc1a4 UTSW 11 20332159 missense probably damaging 1.00
R1992:Slc1a4 UTSW 11 20304375 missense probably benign 0.31
R2497:Slc1a4 UTSW 11 20332620 start gained probably benign
R3498:Slc1a4 UTSW 11 20313973 missense probably damaging 1.00
R4608:Slc1a4 UTSW 11 20304348 missense probably damaging 1.00
R4631:Slc1a4 UTSW 11 20308452 missense probably damaging 1.00
R4885:Slc1a4 UTSW 11 20304384 missense probably damaging 1.00
R4911:Slc1a4 UTSW 11 20332166 missense probably damaging 1.00
R5533:Slc1a4 UTSW 11 20304417 missense probably benign 0.01
R5548:Slc1a4 UTSW 11 20304429 missense possibly damaging 0.68
R6523:Slc1a4 UTSW 11 20332114 missense probably damaging 1.00
R6863:Slc1a4 UTSW 11 20314001 missense probably damaging 1.00
R6941:Slc1a4 UTSW 11 20304346 missense probably damaging 1.00
R7508:Slc1a4 UTSW 11 20306487 missense probably damaging 1.00
R7747:Slc1a4 UTSW 11 20308587 missense probably damaging 1.00
R7748:Slc1a4 UTSW 11 20332252 missense probably damaging 1.00
R7934:Slc1a4 UTSW 11 20308518 missense probably damaging 1.00
R8142:Slc1a4 UTSW 11 20307890 critical splice donor site probably null
R8398:Slc1a4 UTSW 11 20307982 missense probably damaging 1.00
X0025:Slc1a4 UTSW 11 20318703 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTAAGCAACAGCGATGCC -3'
(R):5'- TTCCTTGAGTGTTACCGCTTAGAG -3'

Sequencing Primer
(F):5'- AGCGATGCCACCCAGACG -3'
(R):5'- TTAGAGCGGTGGGCAACGAC -3'
Posted On2020-07-28