Incidental Mutation 'R8301:Calm1'
ID 639278
Institutional Source Beutler Lab
Gene Symbol Calm1
Ensembl Gene ENSMUSG00000001175
Gene Name calmodulin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock # R8301 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 100199435-100209814 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 100205685 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 132 (E132G)
Ref Sequence ENSEMBL: ENSMUSP00000001204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001204] [ENSMUST00000110082]
AlphaFold P0DP26
P0DP27
P0DP28
Predicted Effect probably benign
Transcript: ENSMUST00000001204
AA Change: E132G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000001204
Gene: ENSMUSG00000001175
AA Change: E132G

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
EFh 60 88 6.39e-9 SMART
EFh 96 124 5.19e-9 SMART
EFh 133 161 3.67e-9 SMART
EFh 169 197 1.13e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110082
AA Change: E84G

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105709
Gene: ENSMUSG00000001175
AA Change: E84G

DomainStartEndE-ValueType
EFh 12 40 6.39e-9 SMART
EFh 48 76 5.19e-9 SMART
EFh 85 113 3.67e-9 SMART
EFh 121 149 1.13e-9 SMART
Meta Mutation Damage Score 0.2577 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: This gene encodes a member of the EF-hand calcium-binding protein family. The encoded protein acts as a calcium sensor and is involved in relaying signals to calcium-sensitive proteins, enzymes and ion channels. The protein-calcium complex binds target proteins to regulate several cellular processes, including smooth muscle contraction, inflammation, apoptosis and the immune response. Mutations in the human gene are associated with catecholaminergic polymorphic ventricular tachycardia and long QT syndrome 14. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,972,505 I374F probably benign Het
9430076C15Rik A G 6: 53,681,033 D116G possibly damaging Het
Ak9 G A 10: 41,424,716 V1108I Het
Aldh16a1 C T 7: 45,141,982 A790T possibly damaging Het
Anks1 A T 17: 28,059,580 probably benign Het
Antxr2 T G 5: 97,977,679 T240P probably benign Het
Arfgef1 A T 1: 10,179,833 M945K probably damaging Het
Arhgef17 T C 7: 100,879,659 T1591A probably benign Het
Aurka A G 2: 172,356,930 S374P probably damaging Het
Bccip T C 7: 133,719,204 S236P probably benign Het
Cacna1s T A 1: 136,073,441 probably benign Het
Casz1 A G 4: 148,946,043 D1173G probably damaging Het
Cdh17 A G 4: 11,795,659 D413G probably damaging Het
Cfap57 A G 4: 118,593,074 I617T possibly damaging Het
Csnka2ip A C 16: 64,478,991 S337A unknown Het
Ddx60 A G 8: 62,000,597 E1250G probably benign Het
Dlgap2 T A 8: 14,823,577 S727T probably benign Het
Dpy19l1 T C 9: 24,485,111 probably benign Het
Ebf2 A G 14: 67,238,982 T134A possibly damaging Het
Echdc2 A T 4: 108,172,909 M136L probably benign Het
Enpp2 A G 15: 54,851,407 F598S probably benign Het
Extl3 A C 14: 65,076,284 L483R probably damaging Het
Gcat T C 15: 79,035,889 V227A possibly damaging Het
Hsf2 A G 10: 57,505,346 D344G probably damaging Het
Ighm C T 12: 113,421,545 G265D Het
Igsf9b T G 9: 27,334,739 probably benign Het
Ints6 A G 14: 62,702,453 V596A probably benign Het
Ints8 T C 4: 11,246,120 E182G probably damaging Het
Iqgap2 A G 13: 95,682,151 probably null Het
Kalrn G T 16: 34,357,100 Q250K probably benign Het
Lrrc1 T A 9: 77,544,488 N46Y probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naa50 A G 16: 44,157,131 N74S probably benign Het
Neb T C 2: 52,288,835 N1303S probably benign Het
Nfs1 A T 2: 156,134,493 C160* probably null Het
Olfr472 A G 7: 107,903,626 K303R probably benign Het
Olfr591 T G 7: 103,173,073 K188T probably damaging Het
Olfr740 T A 14: 50,453,564 S171T probably benign Het
Olfr809 T C 10: 129,776,840 S309P probably benign Het
Orm2 T C 4: 63,363,026 F67S possibly damaging Het
Pex5 A G 6: 124,405,183 S180P probably benign Het
Phf14 G C 6: 11,992,062 G746R probably damaging Het
Pkm T A 9: 59,668,631 V110E probably damaging Het
Plekha6 T G 1: 133,264,687 N78K probably damaging Het
Plxna2 G A 1: 194,790,175 V1076I probably benign Het
Polq C A 16: 37,061,819 D1448E probably damaging Het
Pot1b T C 17: 55,687,895 T256A probably benign Het
Prkch C T 12: 73,702,764 T377I possibly damaging Het
Prl3c1 A C 13: 27,199,185 probably benign Het
Prl7b1 A C 13: 27,602,772 V158G possibly damaging Het
Prss22 T C 17: 23,993,981 S261G probably damaging Het
Psd T C 19: 46,321,102 probably benign Het
Psg18 A T 7: 18,353,377 Y119N probably damaging Het
Rbm6 T G 9: 107,852,794 R218S probably damaging Het
Rnf213 T A 11: 119,434,742 S1491T Het
Rsf1 T C 7: 97,661,925 S621P Het
Runx1 C A 16: 92,605,656 *466L probably null Het
Samd4 A G 14: 47,016,678 I200V probably benign Het
Sdsl C T 5: 120,459,519 C241Y probably benign Het
Sepn1 T C 4: 134,551,414 probably benign Het
Setx C T 2: 29,145,690 P729L possibly damaging Het
Sf1 C T 19: 6,368,366 Q55* probably null Het
Slc12a5 A T 2: 164,993,691 N833I probably damaging Het
Slc1a4 T C 11: 20,332,286 R63G probably damaging Het
Tmeff2 G T 1: 51,181,837 A324S probably benign Het
Tmem217 A G 17: 29,526,492 I88T possibly damaging Het
Tnfsf8 A T 4: 63,860,878 I61N probably benign Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trhde T A 10: 114,487,006 E667V probably benign Het
Unc13b A G 4: 43,263,568 T1598A probably benign Het
Vmn2r73 A T 7: 85,858,302 C601S probably benign Het
Zfp873 C A 10: 82,060,879 H481Q probably damaging Het
Other mutations in Calm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02281:Calm1 APN 12 100205624 missense probably damaging 1.00
G1Funyon:Calm1 UTSW 12 100205685 missense probably benign 0.00
R4727:Calm1 UTSW 12 100200226 missense probably benign 0.08
R4817:Calm1 UTSW 12 100203573 critical splice acceptor site probably null
R5187:Calm1 UTSW 12 100200213 missense probably benign 0.10
R8174:Calm1 UTSW 12 100205708 missense probably benign
R9178:Calm1 UTSW 12 100205720 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTGGTTGGCACTTGAGTCC -3'
(R):5'- GGACAGTCAATTCAGTGTTTCTC -3'

Sequencing Primer
(F):5'- ACTTGAGTCCTAGCAGATGC -3'
(R):5'- TGCTGGACCTCACCTCAG -3'
Posted On 2020-07-28