Incidental Mutation 'R8301:Ints6'
ID 639284
Institutional Source Beutler Lab
Gene Symbol Ints6
Ensembl Gene ENSMUSG00000035161
Gene Name integrator complex subunit 6
Synonyms Notch2l, DICE1, Ddx26, 2900075H24Rik
MMRRC Submission 067789-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8301 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 62913779-62998618 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 62939902 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 596 (V596A)
Ref Sequence ENSEMBL: ENSMUSP00000086788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053959]
AlphaFold Q6PCM2
Predicted Effect probably benign
Transcript: ENSMUST00000053959
AA Change: V596A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086788
Gene: ENSMUSG00000035161
AA Change: V596A

DomainStartEndE-ValueType
VWA 1 158 4.11e-1 SMART
Blast:VWA 307 331 1e-7 BLAST
Blast:RRM_2 701 727 3e-8 BLAST
Pfam:INT_SG_DDX_CT_C 803 865 4e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. The protein encoded by this gene is a DEAD box protein that is part of a complex that interacts with the C-terminus of RNA polymerase II and is involved in 3' end processing of snRNAs. In addition, this gene is a candidate tumor suppressor and is located in the critical region of loss of heterozygosity (LOH). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 88,120,364 (GRCm39) I374F probably benign Het
Ak9 G A 10: 41,300,712 (GRCm39) V1108I Het
Aldh16a1 C T 7: 44,791,406 (GRCm39) A790T possibly damaging Het
Anks1 A T 17: 28,278,554 (GRCm39) probably benign Het
Antxr2 T G 5: 98,125,538 (GRCm39) T240P probably benign Het
Arfgef1 A T 1: 10,250,058 (GRCm39) M945K probably damaging Het
Arhgef17 T C 7: 100,528,866 (GRCm39) T1591A probably benign Het
Aurka A G 2: 172,198,850 (GRCm39) S374P probably damaging Het
Bccip T C 7: 133,320,933 (GRCm39) S236P probably benign Het
Cacna1s T A 1: 136,001,179 (GRCm39) probably benign Het
Calm1 A G 12: 100,171,944 (GRCm39) E132G probably benign Het
Casz1 A G 4: 149,030,500 (GRCm39) D1173G probably damaging Het
Cdh17 A G 4: 11,795,659 (GRCm39) D413G probably damaging Het
Cfap57 A G 4: 118,450,271 (GRCm39) I617T possibly damaging Het
Creb5 A G 6: 53,658,018 (GRCm39) D116G possibly damaging Het
Csnka2ip A C 16: 64,299,354 (GRCm39) S337A unknown Het
Ddx60 A G 8: 62,453,631 (GRCm39) E1250G probably benign Het
Dlgap2 T A 8: 14,873,577 (GRCm39) S727T probably benign Het
Dpy19l1 T C 9: 24,396,407 (GRCm39) probably benign Het
Ebf2 A G 14: 67,476,431 (GRCm39) T134A possibly damaging Het
Echdc2 A T 4: 108,030,106 (GRCm39) M136L probably benign Het
Enpp2 A G 15: 54,714,803 (GRCm39) F598S probably benign Het
Extl3 A C 14: 65,313,733 (GRCm39) L483R probably damaging Het
Gcat T C 15: 78,920,089 (GRCm39) V227A possibly damaging Het
Hsf2 A G 10: 57,381,442 (GRCm39) D344G probably damaging Het
Ighm C T 12: 113,385,165 (GRCm39) G265D Het
Igsf9b T G 9: 27,246,035 (GRCm39) probably benign Het
Ints8 T C 4: 11,246,120 (GRCm39) E182G probably damaging Het
Iqgap2 A G 13: 95,818,659 (GRCm39) probably null Het
Kalrn G T 16: 34,177,470 (GRCm39) Q250K probably benign Het
Lrrc1 T A 9: 77,451,770 (GRCm39) N46Y probably damaging Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Naa50 A G 16: 43,977,494 (GRCm39) N74S probably benign Het
Neb T C 2: 52,178,847 (GRCm39) N1303S probably benign Het
Nfs1 A T 2: 155,976,413 (GRCm39) C160* probably null Het
Or11g7 T A 14: 50,691,021 (GRCm39) S171T probably benign Het
Or52s1b T G 7: 102,822,280 (GRCm39) K188T probably damaging Het
Or5p52 A G 7: 107,502,833 (GRCm39) K303R probably benign Het
Or6c76 T C 10: 129,612,709 (GRCm39) S309P probably benign Het
Orm2 T C 4: 63,281,263 (GRCm39) F67S possibly damaging Het
Pex5 A G 6: 124,382,142 (GRCm39) S180P probably benign Het
Phf14 G C 6: 11,992,061 (GRCm39) G746R probably damaging Het
Pkm T A 9: 59,575,914 (GRCm39) V110E probably damaging Het
Plekha6 T G 1: 133,192,425 (GRCm39) N78K probably damaging Het
Plxna2 G A 1: 194,472,483 (GRCm39) V1076I probably benign Het
Polq C A 16: 36,882,181 (GRCm39) D1448E probably damaging Het
Pot1b T C 17: 55,994,895 (GRCm39) T256A probably benign Het
Prkch C T 12: 73,749,538 (GRCm39) T377I possibly damaging Het
Prl3c1 A C 13: 27,383,168 (GRCm39) probably benign Het
Prl7b1 A C 13: 27,786,755 (GRCm39) V158G possibly damaging Het
Prss22 T C 17: 24,212,955 (GRCm39) S261G probably damaging Het
Psd T C 19: 46,309,541 (GRCm39) probably benign Het
Psg18 A T 7: 18,087,302 (GRCm39) Y119N probably damaging Het
Rbm6 T G 9: 107,729,993 (GRCm39) R218S probably damaging Het
Rnf213 T A 11: 119,325,568 (GRCm39) S1491T Het
Rsf1 T C 7: 97,311,132 (GRCm39) S621P Het
Runx1 C A 16: 92,402,544 (GRCm39) *466L probably null Het
Samd4 A G 14: 47,254,135 (GRCm39) I200V probably benign Het
Sdsl C T 5: 120,597,584 (GRCm39) C241Y probably benign Het
Selenon T C 4: 134,278,725 (GRCm39) probably benign Het
Setx C T 2: 29,035,702 (GRCm39) P729L possibly damaging Het
Sf1 C T 19: 6,418,396 (GRCm39) Q55* probably null Het
Slc12a5 A T 2: 164,835,611 (GRCm39) N833I probably damaging Het
Slc1a4 T C 11: 20,282,286 (GRCm39) R63G probably damaging Het
Tmeff2 G T 1: 51,220,996 (GRCm39) A324S probably benign Het
Tmem217 A G 17: 29,745,466 (GRCm39) I88T possibly damaging Het
Tnfsf8 A T 4: 63,779,115 (GRCm39) I61N probably benign Het
Tpbgl G T 7: 99,274,774 (GRCm39) A361E probably damaging Het
Trhde T A 10: 114,322,911 (GRCm39) E667V probably benign Het
Unc13b A G 4: 43,263,568 (GRCm39) T1598A probably benign Het
Vmn2r73 A T 7: 85,507,510 (GRCm39) C601S probably benign Het
Zfp873 C A 10: 81,896,713 (GRCm39) H481Q probably damaging Het
Other mutations in Ints6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Ints6 APN 14 62,940,628 (GRCm39) missense probably damaging 1.00
IGL00763:Ints6 APN 14 62,938,314 (GRCm39) splice site probably benign
IGL01624:Ints6 APN 14 62,934,320 (GRCm39) missense probably benign 0.07
IGL01721:Ints6 APN 14 62,951,188 (GRCm39) missense probably damaging 0.96
IGL02146:Ints6 APN 14 62,996,709 (GRCm39) missense possibly damaging 0.91
G1Funyon:Ints6 UTSW 14 62,939,902 (GRCm39) missense probably benign
R0302:Ints6 UTSW 14 62,946,961 (GRCm39) missense probably damaging 1.00
R0320:Ints6 UTSW 14 62,945,084 (GRCm39) nonsense probably null
R0543:Ints6 UTSW 14 62,934,060 (GRCm39) missense probably damaging 1.00
R0554:Ints6 UTSW 14 62,942,200 (GRCm39) missense possibly damaging 0.87
R0620:Ints6 UTSW 14 62,934,208 (GRCm39) missense probably benign
R0960:Ints6 UTSW 14 62,947,015 (GRCm39) missense probably benign 0.39
R1216:Ints6 UTSW 14 62,945,147 (GRCm39) missense probably damaging 1.00
R1254:Ints6 UTSW 14 62,953,823 (GRCm39) missense probably benign 0.27
R1296:Ints6 UTSW 14 62,942,352 (GRCm39) splice site probably benign
R1548:Ints6 UTSW 14 62,951,141 (GRCm39) missense probably damaging 1.00
R1944:Ints6 UTSW 14 62,931,089 (GRCm39) missense probably benign 0.03
R2040:Ints6 UTSW 14 62,951,138 (GRCm39) missense probably damaging 0.99
R2279:Ints6 UTSW 14 62,942,131 (GRCm39) critical splice donor site probably null
R2844:Ints6 UTSW 14 62,942,275 (GRCm39) missense probably damaging 0.97
R3107:Ints6 UTSW 14 62,998,041 (GRCm39) missense possibly damaging 0.92
R3407:Ints6 UTSW 14 62,934,386 (GRCm39) missense probably benign 0.00
R3895:Ints6 UTSW 14 62,934,060 (GRCm39) missense probably damaging 1.00
R4608:Ints6 UTSW 14 62,940,678 (GRCm39) missense probably damaging 1.00
R4903:Ints6 UTSW 14 62,939,911 (GRCm39) missense probably damaging 1.00
R4964:Ints6 UTSW 14 62,939,911 (GRCm39) missense probably damaging 1.00
R4966:Ints6 UTSW 14 62,939,911 (GRCm39) missense probably damaging 1.00
R5014:Ints6 UTSW 14 62,997,640 (GRCm39) missense probably benign 0.00
R5369:Ints6 UTSW 14 62,981,384 (GRCm39) missense probably damaging 1.00
R6478:Ints6 UTSW 14 62,938,235 (GRCm39) missense probably benign 0.37
R7022:Ints6 UTSW 14 62,951,786 (GRCm39) missense probably damaging 1.00
R7403:Ints6 UTSW 14 62,945,104 (GRCm39) missense possibly damaging 0.50
R7422:Ints6 UTSW 14 62,942,224 (GRCm39) missense probably benign
R7909:Ints6 UTSW 14 62,996,779 (GRCm39) missense probably damaging 0.99
R8147:Ints6 UTSW 14 62,951,186 (GRCm39) missense probably damaging 1.00
R8496:Ints6 UTSW 14 62,943,325 (GRCm39) missense probably benign 0.06
R8502:Ints6 UTSW 14 62,998,028 (GRCm39) missense possibly damaging 0.92
R8514:Ints6 UTSW 14 62,933,166 (GRCm39) missense possibly damaging 0.89
R8540:Ints6 UTSW 14 62,934,353 (GRCm39) missense probably benign 0.39
R8733:Ints6 UTSW 14 62,934,297 (GRCm39) missense probably benign 0.01
R8810:Ints6 UTSW 14 62,939,902 (GRCm39) missense probably benign 0.02
R8839:Ints6 UTSW 14 62,931,122 (GRCm39) missense probably benign 0.06
R9057:Ints6 UTSW 14 62,951,740 (GRCm39) critical splice donor site probably null
R9178:Ints6 UTSW 14 62,947,036 (GRCm39) missense probably damaging 1.00
R9318:Ints6 UTSW 14 62,934,147 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTTAATGAGATATTCCTCCCCAA -3'
(R):5'- TGCTATGACTAAAGCCTTCTCATC -3'

Sequencing Primer
(F):5'- TATTCCTCCCCAAAAATAACTTAAGC -3'
(R):5'- GACTAAAGCCTTCTCATCATTACACG -3'
Posted On 2020-07-28