Mutagenetix > Incidental Mutations

Incidental Mutation 'R8301:Ints6'

639284

Institutional Source

Beutler Lab

Gene Symbol

Ints6

Ensembl Gene

ENSMUSG00000035161

Gene Name

integrator complex subunit 6

Synonyms

DICE1, Notch2l, Ddx26, 2900075H24Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8301 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

62676330-62761169 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 62702453 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 596 (V596A)

Ref Sequence

ENSEMBL: ENSMUSP00000086788 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053959]

AlphaFold

Q6PCM2

Predicted Effect

probably benign
Transcript: ENSMUST00000053959
AA Change: V596A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000086788
Gene: ENSMUSG00000035161
AA Change: V596A

Domain	Start	End	E-Value	Type
VWA	1	158	4.11e-1	SMART
Blast:VWA	307	331	1e-7	BLAST
Blast:RRM_2	701	727	3e-8	BLAST
Pfam:INT_SG_DDX_CT_C	803	865	4e-30	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. The protein encoded by this gene is a DEAD box protein that is part of a complex that interacts with the C-terminus of RNA polymerase II and is involved in 3' end processing of snRNAs. In addition, this gene is a candidate tumor suppressor and is located in the critical region of loss of heterozygosity (LOH). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	A	T	5: 87,972,505	I374F	probably benign	Het
9430076C15Rik	A	G	6: 53,681,033	D116G	possibly damaging	Het
Ak9	G	A	10: 41,424,716	V1108I		Het
Aldh16a1	C	T	7: 45,141,982	A790T	possibly damaging	Het
Anks1	A	T	17: 28,059,580		probably benign	Het
Antxr2	T	G	5: 97,977,679	T240P	probably benign	Het
Arfgef1	A	T	1: 10,179,833	M945K	probably damaging	Het
Arhgef17	T	C	7: 100,879,659	T1591A	probably benign	Het
Aurka	A	G	2: 172,356,930	S374P	probably damaging	Het
Bccip	T	C	7: 133,719,204	S236P	probably benign	Het
Cacna1s	T	A	1: 136,073,441		probably benign	Het
Calm1	A	G	12: 100,205,685	E132G	probably benign	Het
Casz1	A	G	4: 148,946,043	D1173G	probably damaging	Het
Cdh17	A	G	4: 11,795,659	D413G	probably damaging	Het
Cfap57	A	G	4: 118,593,074	I617T	possibly damaging	Het
Csnka2ip	A	C	16: 64,478,991	S337A	unknown	Het
Ddx60	A	G	8: 62,000,597	E1250G	probably benign	Het
Dlgap2	T	A	8: 14,823,577	S727T	probably benign	Het
Dpy19l1	T	C	9: 24,485,111		probably benign	Het
Ebf2	A	G	14: 67,238,982	T134A	possibly damaging	Het
Echdc2	A	T	4: 108,172,909	M136L	probably benign	Het
Enpp2	A	G	15: 54,851,407	F598S	probably benign	Het
Extl3	A	C	14: 65,076,284	L483R	probably damaging	Het
Gcat	T	C	15: 79,035,889	V227A	possibly damaging	Het
Hsf2	A	G	10: 57,505,346	D344G	probably damaging	Het
Ighm	C	T	12: 113,421,545	G265D		Het
Igsf9b	T	G	9: 27,334,739		probably benign	Het
Ints8	T	C	4: 11,246,120	E182G	probably damaging	Het
Iqgap2	A	G	13: 95,682,151		probably null	Het
Kalrn	G	T	16: 34,357,100	Q250K	probably benign	Het
Lrrc1	T	A	9: 77,544,488	N46Y	probably damaging	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Naa50	A	G	16: 44,157,131	N74S	probably benign	Het
Neb	T	C	2: 52,288,835	N1303S	probably benign	Het
Nfs1	A	T	2: 156,134,493	C160*	probably null	Het
Olfr472	A	G	7: 107,903,626	K303R	probably benign	Het
Olfr591	T	G	7: 103,173,073	K188T	probably damaging	Het
Olfr740	T	A	14: 50,453,564	S171T	probably benign	Het
Olfr809	T	C	10: 129,776,840	S309P	probably benign	Het
Orm2	T	C	4: 63,363,026	F67S	possibly damaging	Het
Pex5	A	G	6: 124,405,183	S180P	probably benign	Het
Phf14	G	C	6: 11,992,062	G746R	probably damaging	Het
Pkm	T	A	9: 59,668,631	V110E	probably damaging	Het
Plekha6	T	G	1: 133,264,687	N78K	probably damaging	Het
Plxna2	G	A	1: 194,790,175	V1076I	probably benign	Het
Polq	C	A	16: 37,061,819	D1448E	probably damaging	Het
Pot1b	T	C	17: 55,687,895	T256A	probably benign	Het
Prkch	C	T	12: 73,702,764	T377I	possibly damaging	Het
Prl3c1	A	C	13: 27,199,185		probably benign	Het
Prl7b1	A	C	13: 27,602,772	V158G	possibly damaging	Het
Prss22	T	C	17: 23,993,981	S261G	probably damaging	Het
Psd	T	C	19: 46,321,102		probably benign	Het
Psg18	A	T	7: 18,353,377	Y119N	probably damaging	Het
Rbm6	T	G	9: 107,852,794	R218S	probably damaging	Het
Rnf213	T	A	11: 119,434,742	S1491T		Het
Rsf1	T	C	7: 97,661,925	S621P		Het
Runx1	C	A	16: 92,605,656	*466L	probably null	Het
Samd4	A	G	14: 47,016,678	I200V	probably benign	Het
Sdsl	C	T	5: 120,459,519	C241Y	probably benign	Het
Sepn1	T	C	4: 134,551,414		probably benign	Het
Setx	C	T	2: 29,145,690	P729L	possibly damaging	Het
Sf1	C	T	19: 6,368,366	Q55*	probably null	Het
Slc12a5	A	T	2: 164,993,691	N833I	probably damaging	Het
Slc1a4	T	C	11: 20,332,286	R63G	probably damaging	Het
Tmeff2	G	T	1: 51,181,837	A324S	probably benign	Het
Tmem217	A	G	17: 29,526,492	I88T	possibly damaging	Het
Tnfsf8	A	T	4: 63,860,878	I61N	probably benign	Het
Tpbgl	G	T	7: 99,625,567	A361E	probably damaging	Het
Trhde	T	A	10: 114,487,006	E667V	probably benign	Het
Unc13b	A	G	4: 43,263,568	T1598A	probably benign	Het
Vmn2r73	A	T	7: 85,858,302	C601S	probably benign	Het
Zfp873	C	A	10: 82,060,879	H481Q	probably damaging	Het

Other mutations in Ints6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00535:Ints6	APN	14	62703179	missense	probably damaging	1.00
IGL00763:Ints6	APN	14	62700865	splice site	probably benign
IGL01624:Ints6	APN	14	62696871	missense	probably benign	0.07
IGL01721:Ints6	APN	14	62713739	missense	probably damaging	0.96
IGL02146:Ints6	APN	14	62759260	missense	possibly damaging	0.91
G1Funyon:Ints6	UTSW	14	62702453	missense	probably benign
R0302:Ints6	UTSW	14	62709512	missense	probably damaging	1.00
R0320:Ints6	UTSW	14	62707635	nonsense	probably null
R0543:Ints6	UTSW	14	62696611	missense	probably damaging	1.00
R0554:Ints6	UTSW	14	62704751	missense	possibly damaging	0.87
R0620:Ints6	UTSW	14	62696759	missense	probably benign
R0960:Ints6	UTSW	14	62709566	missense	probably benign	0.39
R1216:Ints6	UTSW	14	62707698	missense	probably damaging	1.00
R1254:Ints6	UTSW	14	62716374	missense	probably benign	0.27
R1296:Ints6	UTSW	14	62704903	splice site	probably benign
R1548:Ints6	UTSW	14	62713692	missense	probably damaging	1.00
R1944:Ints6	UTSW	14	62693640	missense	probably benign	0.03
R2040:Ints6	UTSW	14	62713689	missense	probably damaging	0.99
R2279:Ints6	UTSW	14	62704682	critical splice donor site	probably null
R2844:Ints6	UTSW	14	62704826	missense	probably damaging	0.97
R3107:Ints6	UTSW	14	62760592	missense	possibly damaging	0.92
R3407:Ints6	UTSW	14	62696937	missense	probably benign	0.00
R3895:Ints6	UTSW	14	62696611	missense	probably damaging	1.00
R4608:Ints6	UTSW	14	62703229	missense	probably damaging	1.00
R4903:Ints6	UTSW	14	62702462	missense	probably damaging	1.00
R4964:Ints6	UTSW	14	62702462	missense	probably damaging	1.00
R4966:Ints6	UTSW	14	62702462	missense	probably damaging	1.00
R5014:Ints6	UTSW	14	62760191	missense	probably benign	0.00
R5369:Ints6	UTSW	14	62743935	missense	probably damaging	1.00
R6478:Ints6	UTSW	14	62700786	missense	probably benign	0.37
R7022:Ints6	UTSW	14	62714337	missense	probably damaging	1.00
R7403:Ints6	UTSW	14	62707655	missense	possibly damaging	0.50
R7422:Ints6	UTSW	14	62704775	missense	probably benign
R7909:Ints6	UTSW	14	62759330	missense	probably damaging	0.99
R8147:Ints6	UTSW	14	62713737	missense	probably damaging	1.00
R8496:Ints6	UTSW	14	62705876	missense	probably benign	0.06
R8502:Ints6	UTSW	14	62760579	missense	possibly damaging	0.92
R8514:Ints6	UTSW	14	62695717	missense	possibly damaging	0.89
R8540:Ints6	UTSW	14	62696904	missense	probably benign	0.39
R8733:Ints6	UTSW	14	62696848	missense	probably benign	0.01
R8810:Ints6	UTSW	14	62702453	missense	probably benign	0.02
R8839:Ints6	UTSW	14	62693673	missense	probably benign	0.06
R9057:Ints6	UTSW	14	62714291	critical splice donor site	probably null
R9178:Ints6	UTSW	14	62709587	missense	probably damaging	1.00
R9318:Ints6	UTSW	14	62696698	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACTTTAATGAGATATTCCTCCCCAA -3'
(R):5'- TGCTATGACTAAAGCCTTCTCATC -3'

Sequencing Primer
(F):5'- TATTCCTCCCCAAAAATAACTTAAGC -3'
(R):5'- GACTAAAGCCTTCTCATCATTACACG -3'

Posted On

2020-07-28