Incidental Mutation 'R8301:Ints6'
ID 639284
Institutional Source Beutler Lab
Gene Symbol Ints6
Ensembl Gene ENSMUSG00000035161
Gene Name integrator complex subunit 6
Synonyms DICE1, Notch2l, Ddx26, 2900075H24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8301 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 62676330-62761169 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 62702453 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 596 (V596A)
Ref Sequence ENSEMBL: ENSMUSP00000086788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053959]
AlphaFold Q6PCM2
Predicted Effect probably benign
Transcript: ENSMUST00000053959
AA Change: V596A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086788
Gene: ENSMUSG00000035161
AA Change: V596A

DomainStartEndE-ValueType
VWA 1 158 4.11e-1 SMART
Blast:VWA 307 331 1e-7 BLAST
Blast:RRM_2 701 727 3e-8 BLAST
Pfam:INT_SG_DDX_CT_C 803 865 4e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. The protein encoded by this gene is a DEAD box protein that is part of a complex that interacts with the C-terminus of RNA polymerase II and is involved in 3' end processing of snRNAs. In addition, this gene is a candidate tumor suppressor and is located in the critical region of loss of heterozygosity (LOH). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,972,505 I374F probably benign Het
9430076C15Rik A G 6: 53,681,033 D116G possibly damaging Het
Ak9 G A 10: 41,424,716 V1108I Het
Aldh16a1 C T 7: 45,141,982 A790T possibly damaging Het
Anks1 A T 17: 28,059,580 probably benign Het
Antxr2 T G 5: 97,977,679 T240P probably benign Het
Arfgef1 A T 1: 10,179,833 M945K probably damaging Het
Arhgef17 T C 7: 100,879,659 T1591A probably benign Het
Aurka A G 2: 172,356,930 S374P probably damaging Het
Bccip T C 7: 133,719,204 S236P probably benign Het
Cacna1s T A 1: 136,073,441 probably benign Het
Calm1 A G 12: 100,205,685 E132G probably benign Het
Casz1 A G 4: 148,946,043 D1173G probably damaging Het
Cdh17 A G 4: 11,795,659 D413G probably damaging Het
Cfap57 A G 4: 118,593,074 I617T possibly damaging Het
Csnka2ip A C 16: 64,478,991 S337A unknown Het
Ddx60 A G 8: 62,000,597 E1250G probably benign Het
Dlgap2 T A 8: 14,823,577 S727T probably benign Het
Dpy19l1 T C 9: 24,485,111 probably benign Het
Ebf2 A G 14: 67,238,982 T134A possibly damaging Het
Echdc2 A T 4: 108,172,909 M136L probably benign Het
Enpp2 A G 15: 54,851,407 F598S probably benign Het
Extl3 A C 14: 65,076,284 L483R probably damaging Het
Gcat T C 15: 79,035,889 V227A possibly damaging Het
Hsf2 A G 10: 57,505,346 D344G probably damaging Het
Ighm C T 12: 113,421,545 G265D Het
Igsf9b T G 9: 27,334,739 probably benign Het
Ints8 T C 4: 11,246,120 E182G probably damaging Het
Iqgap2 A G 13: 95,682,151 probably null Het
Kalrn G T 16: 34,357,100 Q250K probably benign Het
Lrrc1 T A 9: 77,544,488 N46Y probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naa50 A G 16: 44,157,131 N74S probably benign Het
Neb T C 2: 52,288,835 N1303S probably benign Het
Nfs1 A T 2: 156,134,493 C160* probably null Het
Olfr472 A G 7: 107,903,626 K303R probably benign Het
Olfr591 T G 7: 103,173,073 K188T probably damaging Het
Olfr740 T A 14: 50,453,564 S171T probably benign Het
Olfr809 T C 10: 129,776,840 S309P probably benign Het
Orm2 T C 4: 63,363,026 F67S possibly damaging Het
Pex5 A G 6: 124,405,183 S180P probably benign Het
Phf14 G C 6: 11,992,062 G746R probably damaging Het
Pkm T A 9: 59,668,631 V110E probably damaging Het
Plekha6 T G 1: 133,264,687 N78K probably damaging Het
Plxna2 G A 1: 194,790,175 V1076I probably benign Het
Polq C A 16: 37,061,819 D1448E probably damaging Het
Pot1b T C 17: 55,687,895 T256A probably benign Het
Prkch C T 12: 73,702,764 T377I possibly damaging Het
Prl3c1 A C 13: 27,199,185 probably benign Het
Prl7b1 A C 13: 27,602,772 V158G possibly damaging Het
Prss22 T C 17: 23,993,981 S261G probably damaging Het
Psd T C 19: 46,321,102 probably benign Het
Psg18 A T 7: 18,353,377 Y119N probably damaging Het
Rbm6 T G 9: 107,852,794 R218S probably damaging Het
Rnf213 T A 11: 119,434,742 S1491T Het
Rsf1 T C 7: 97,661,925 S621P Het
Runx1 C A 16: 92,605,656 *466L probably null Het
Samd4 A G 14: 47,016,678 I200V probably benign Het
Sdsl C T 5: 120,459,519 C241Y probably benign Het
Sepn1 T C 4: 134,551,414 probably benign Het
Setx C T 2: 29,145,690 P729L possibly damaging Het
Sf1 C T 19: 6,368,366 Q55* probably null Het
Slc12a5 A T 2: 164,993,691 N833I probably damaging Het
Slc1a4 T C 11: 20,332,286 R63G probably damaging Het
Tmeff2 G T 1: 51,181,837 A324S probably benign Het
Tmem217 A G 17: 29,526,492 I88T possibly damaging Het
Tnfsf8 A T 4: 63,860,878 I61N probably benign Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trhde T A 10: 114,487,006 E667V probably benign Het
Unc13b A G 4: 43,263,568 T1598A probably benign Het
Vmn2r73 A T 7: 85,858,302 C601S probably benign Het
Zfp873 C A 10: 82,060,879 H481Q probably damaging Het
Other mutations in Ints6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Ints6 APN 14 62703179 missense probably damaging 1.00
IGL00763:Ints6 APN 14 62700865 splice site probably benign
IGL01624:Ints6 APN 14 62696871 missense probably benign 0.07
IGL01721:Ints6 APN 14 62713739 missense probably damaging 0.96
IGL02146:Ints6 APN 14 62759260 missense possibly damaging 0.91
G1Funyon:Ints6 UTSW 14 62702453 missense probably benign
R0302:Ints6 UTSW 14 62709512 missense probably damaging 1.00
R0320:Ints6 UTSW 14 62707635 nonsense probably null
R0543:Ints6 UTSW 14 62696611 missense probably damaging 1.00
R0554:Ints6 UTSW 14 62704751 missense possibly damaging 0.87
R0620:Ints6 UTSW 14 62696759 missense probably benign
R0960:Ints6 UTSW 14 62709566 missense probably benign 0.39
R1216:Ints6 UTSW 14 62707698 missense probably damaging 1.00
R1254:Ints6 UTSW 14 62716374 missense probably benign 0.27
R1296:Ints6 UTSW 14 62704903 splice site probably benign
R1548:Ints6 UTSW 14 62713692 missense probably damaging 1.00
R1944:Ints6 UTSW 14 62693640 missense probably benign 0.03
R2040:Ints6 UTSW 14 62713689 missense probably damaging 0.99
R2279:Ints6 UTSW 14 62704682 critical splice donor site probably null
R2844:Ints6 UTSW 14 62704826 missense probably damaging 0.97
R3107:Ints6 UTSW 14 62760592 missense possibly damaging 0.92
R3407:Ints6 UTSW 14 62696937 missense probably benign 0.00
R3895:Ints6 UTSW 14 62696611 missense probably damaging 1.00
R4608:Ints6 UTSW 14 62703229 missense probably damaging 1.00
R4903:Ints6 UTSW 14 62702462 missense probably damaging 1.00
R4964:Ints6 UTSW 14 62702462 missense probably damaging 1.00
R4966:Ints6 UTSW 14 62702462 missense probably damaging 1.00
R5014:Ints6 UTSW 14 62760191 missense probably benign 0.00
R5369:Ints6 UTSW 14 62743935 missense probably damaging 1.00
R6478:Ints6 UTSW 14 62700786 missense probably benign 0.37
R7022:Ints6 UTSW 14 62714337 missense probably damaging 1.00
R7403:Ints6 UTSW 14 62707655 missense possibly damaging 0.50
R7422:Ints6 UTSW 14 62704775 missense probably benign
R7909:Ints6 UTSW 14 62759330 missense probably damaging 0.99
R8147:Ints6 UTSW 14 62713737 missense probably damaging 1.00
R8496:Ints6 UTSW 14 62705876 missense probably benign 0.06
R8502:Ints6 UTSW 14 62760579 missense possibly damaging 0.92
R8514:Ints6 UTSW 14 62695717 missense possibly damaging 0.89
R8540:Ints6 UTSW 14 62696904 missense probably benign 0.39
R8733:Ints6 UTSW 14 62696848 missense probably benign 0.01
R8810:Ints6 UTSW 14 62702453 missense probably benign 0.02
R8839:Ints6 UTSW 14 62693673 missense probably benign 0.06
R9057:Ints6 UTSW 14 62714291 critical splice donor site probably null
R9178:Ints6 UTSW 14 62709587 missense probably damaging 1.00
R9318:Ints6 UTSW 14 62696698 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTTAATGAGATATTCCTCCCCAA -3'
(R):5'- TGCTATGACTAAAGCCTTCTCATC -3'

Sequencing Primer
(F):5'- TATTCCTCCCCAAAAATAACTTAAGC -3'
(R):5'- GACTAAAGCCTTCTCATCATTACACG -3'
Posted On 2020-07-28